ID: 1075734738

View in Genome Browser
Species Human (GRCh38)
Location 10:124657393-124657415
Sequence CAGGAGTCCATGGATTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075734738_1075734744 -10 Left 1075734738 10:124657393-124657415 CCTGTGGAATCCATGGACTCCTG 0: 1
1: 0
2: 0
3: 13
4: 144
Right 1075734744 10:124657406-124657428 TGGACTCCTGGGGCTAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075734738 Original CRISPR CAGGAGTCCATGGATTCCAC AGG (reversed) Intronic
900145159 1:1156021-1156043 CAGGAGTCCTGGGATTCCTCAGG + Intergenic
900738701 1:4317132-4317154 TGGGAGGCCATGGATTCCAAGGG - Intergenic
900900200 1:5510811-5510833 CAGGAGTCCCAGGATGCCAGAGG - Intergenic
900917571 1:5649522-5649544 CCCGAATCCTTGGATTCCACGGG + Intergenic
904042183 1:27591336-27591358 CAGGAGACCTGGGATCCCACGGG + Intronic
907103810 1:51861967-51861989 CATGAGTCCATGGATAACATTGG + Intronic
907212004 1:52831896-52831918 CATGAGTCCATGCTTACCACTGG + Intergenic
907497395 1:54853975-54853997 GAGGAGACCATGGATTCCAAGGG + Intronic
912512674 1:110199453-110199475 CAGGGGTCCCTGGAGTTCACAGG + Exonic
912734184 1:112135474-112135496 CAGGAGTCTATGGAGCCCAGAGG + Intergenic
915327498 1:155087917-155087939 CTGGAGTCTATGGATTTCAGGGG + Intergenic
922172676 1:223168841-223168863 CAGGAGCCCATGCAATCAACTGG + Intergenic
922852431 1:228745063-228745085 CAGGAGTCCTCAGAGTCCACTGG - Exonic
923036028 1:230285658-230285680 AAGGAGTCCATGGCATCAACAGG - Intergenic
1065968988 10:30791070-30791092 CAGGAGGCCAAGGGGTCCACAGG - Intergenic
1069559041 10:69416784-69416806 CGGGAGTCTCTGGAGTCCACAGG + Exonic
1072257855 10:93638044-93638066 CAGGATTTCATGGATTCCAGAGG - Intronic
1073975402 10:109095256-109095278 CAGGAGTCGATGCAATCAACTGG - Intergenic
1074359211 10:112811777-112811799 GAGGAGCCCAGGAATTCCACTGG - Intronic
1075734738 10:124657393-124657415 CAGGAGTCCATGGATTCCACAGG - Intronic
1076378832 10:130011329-130011351 CAGGGGTCCATGGTTTCAGCTGG + Intergenic
1076719325 10:132386380-132386402 CAGGAGGACATGGATTCCCATGG - Intergenic
1076793017 10:132786631-132786653 CTCGAGTCCACGGAATCCACGGG + Intergenic
1077364982 11:2158032-2158054 CAGGAGTCCCTGGACACCAAAGG + Intronic
1078040962 11:7862260-7862282 CAGGAGTCAATGCAATCAACTGG + Intergenic
1078795188 11:14585219-14585241 CAGGAGTCCAAGGCTGCCAAAGG + Intronic
1079135597 11:17774585-17774607 CAGGAGTGCATGGGTTTTACAGG - Intronic
1079462399 11:20694064-20694086 CAGGAGCCCATGCAATCAACTGG - Intronic
1080057600 11:27923275-27923297 CAGGATTCCATGGGTTCTATAGG + Intergenic
1081714546 11:45239530-45239552 CAGGAGTTCATGAGTACCACTGG + Intergenic
1083285099 11:61653577-61653599 CTGGTGTCTATGGATTCCTCTGG - Intergenic
1084617376 11:70245505-70245527 CAGGAGGCCATGGGTCCCGCAGG - Intergenic
1085336568 11:75701236-75701258 CAGGATTTCCTGGATCCCACTGG + Intergenic
1086233181 11:84594813-84594835 CAGGTTTCCATGGATACAACTGG + Intronic
1086968881 11:93058843-93058865 CAGGAATCCTTGGGTTCCAGAGG - Intergenic
1088595459 11:111437379-111437401 CAGGAGTCCCTGGACTCATCTGG - Intronic
1089041794 11:115458584-115458606 CAAAAGTCCCTGGAATCCACTGG + Intronic
1090229716 11:125092793-125092815 CCGGAGCCCTTTGATTCCACTGG - Intergenic
1090268852 11:125371584-125371606 CAGGACACCATGGTTTCCATGGG - Intronic
1090446553 11:126769464-126769486 CAGGAGTGCACGGTTTTCACGGG - Intronic
1092620398 12:10259113-10259135 CAGGAGGCCATGGGTTACTCAGG - Intergenic
1096992434 12:55815783-55815805 CAGAGGTCCATGGACTCCTCGGG + Intronic
1097810514 12:64013843-64013865 CAGGTGACCCTGGATTCCAAAGG - Intronic
1099829490 12:87822032-87822054 CAGAAGTCCATGGAGACGACTGG + Intergenic
1104067260 12:125316198-125316220 CTGGATTCCAGGGATTACACAGG + Intronic
1104526943 12:129532772-129532794 CAGGAGTTCAGGGTTTTCACTGG - Intronic
1109476586 13:62887138-62887160 AATGTGTCCATGGATGCCACTGG - Intergenic
1115990299 14:39143512-39143534 TTGGAGTCCTGGGATTCCACAGG - Intergenic
1117192085 14:53303168-53303190 CAGGAGCCGATGGAATCAACTGG - Intergenic
1117211576 14:53506451-53506473 CAGGAGTGCATGGATGCCAATGG - Intergenic
1118446825 14:65859639-65859661 CAGGAGCCAATGCAATCCACTGG - Intergenic
1120709170 14:87775233-87775255 CAGGGGCCTTTGGATTCCACAGG - Intergenic
1121245976 14:92461025-92461047 CTGCAGACCATGGTTTCCACGGG - Intronic
1121376643 14:93417800-93417822 CAGGAGTCGATGCAATCAACTGG - Intronic
1121957681 14:98228979-98229001 CAGGAGGCCATGGATGGCAGTGG - Intergenic
1124652840 15:31485738-31485760 CAGGCGTCCCTGGCTTCCAGGGG + Intronic
1126195723 15:45928303-45928325 CAGGAGTATATGGAATCCTCAGG + Intergenic
1128064946 15:64758751-64758773 GAGGGGTCCATGGACCCCACAGG + Intronic
1129904441 15:79176319-79176341 CAGGAGTCCAGGGCAGCCACTGG - Intergenic
1131228488 15:90644050-90644072 CAGGAATACTTGGATTCCAGAGG - Intronic
1133016302 16:2943187-2943209 CAGGAGTCCAGGGTTTTCACTGG - Intronic
1135691893 16:24544847-24544869 CAGGAACCCAGGGATTCCTCTGG + Intronic
1136078284 16:27831917-27831939 AGCGAGTCCAGGGATTCCACAGG - Intronic
1136336755 16:29614915-29614937 CAGGATTCTGTGGATTCCAGAGG - Intergenic
1138261983 16:55630360-55630382 CAGCAGCCCTTGGATTCCAGAGG - Intergenic
1143634387 17:8156070-8156092 CAAGTGTCCAGGGACTCCACGGG + Intronic
1144283428 17:13749528-13749550 CAGGAATCCAAGGGTTACACAGG - Intergenic
1147403095 17:40192591-40192613 CAGGGGTCCTAGTATTCCACAGG - Exonic
1156881382 18:42084907-42084929 CTGTAGTCCAGAGATTCCACAGG + Exonic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1157585268 18:48797049-48797071 CAGGAGGCCTTGGAGTCCACAGG - Intronic
1163436102 19:17296073-17296095 CAGGTGTCCATGGACCCCAGGGG - Intronic
926469452 2:13236047-13236069 CATAAGACTATGGATTCCACAGG - Intergenic
928121427 2:28586562-28586584 CAGGAGTCCCTGGACTCCTTGGG + Intronic
928450588 2:31374897-31374919 CAGGAGGCCGTGGAATCCATAGG - Intronic
928739911 2:34339049-34339071 CAGTCTTCCATGGATTCCCCAGG + Intergenic
929638207 2:43547644-43547666 CAGGAGCCGATGCAATCCACTGG - Intronic
932515283 2:72340892-72340914 CAGGAGTTGATGTACTCCACAGG + Intronic
933068745 2:77832528-77832550 CAGCAGCCCTTGGATTCCATAGG - Intergenic
939881763 2:147639477-147639499 CAGGAGTGCATGGATTTCATAGG + Intergenic
941318230 2:164021719-164021741 CAGGATTCCATGTCTTTCACAGG + Intergenic
941734163 2:168954728-168954750 CAGAAGTCCAGTGATTCCCCAGG - Intronic
942073846 2:172339015-172339037 CTGTAGTCCATGGAGTCCACTGG - Intergenic
942378049 2:175357035-175357057 CAGGAGTCCTTGGCATCCTCTGG + Intergenic
943562874 2:189484137-189484159 AAGGAGTCCATGGACTCACCTGG + Intergenic
945485471 2:210390325-210390347 CAGGAGCCTATGGATTCAAAGGG + Intergenic
946175831 2:217921487-217921509 CAGCAGCCCAGGGATTCCCCAGG + Intronic
947022190 2:225691784-225691806 CAGGAGACCATGGATAGCATTGG - Intergenic
947821915 2:233078160-233078182 CAGCAGCCGATGGATTCCATGGG + Intronic
948199383 2:236119099-236119121 GAGGAGACCATGTATTACACTGG + Intronic
948386343 2:237583448-237583470 GAGGAGACCATGGTTCCCACAGG + Intronic
948601792 2:239111642-239111664 CAGGCGTCCATGGAGGCCGCCGG - Exonic
948860810 2:240751800-240751822 CATGGGTCCATGGATGCCCCGGG + Intronic
1171388992 20:24789308-24789330 CAGGGGTTCATGGATTCCTGAGG - Intergenic
1171912350 20:30975223-30975245 CAGGAGACAATGGAATCAACTGG - Intergenic
1172188782 20:33049123-33049145 CAGCAGCCCATGGATTACCCTGG - Intergenic
1172610126 20:36244605-36244627 CACAAGGCCATGAATTCCACTGG - Intronic
1174083113 20:47984695-47984717 CGGGAGTCACTGGATTCCACAGG + Intergenic
1174345567 20:49926915-49926937 CTGGAGTGCACGGATTCCAATGG - Intergenic
1176297065 21:5079536-5079558 CAGGAGACCACGGAGACCACAGG + Intergenic
1179859963 21:44182411-44182433 CAGGAGACCACGGAGACCACAGG - Intergenic
1181488146 22:23244592-23244614 CGTGACTCCATGGATTCCGCTGG + Intronic
1183737751 22:39653336-39653358 CAGGAGACCATGGCTGCCCCTGG - Intronic
1184518830 22:44980253-44980275 CAGGAGTCCAGATCTTCCACTGG - Intronic
1184813412 22:46852696-46852718 CAGGAGTCAATAGATTCAGCAGG - Intronic
949343662 3:3056015-3056037 CAGAACTGCATGGATTCTACTGG - Intronic
949468258 3:4366494-4366516 CAGGAGTCGATGCAATCAACTGG - Intronic
951966494 3:28391622-28391644 AAGGTGTCCATGGCTTCCACAGG - Intronic
955345230 3:58156117-58156139 CAGGAGTCCAGGGGTCTCACTGG - Intronic
955360578 3:58270754-58270776 GAGAAGTCCATGCATGCCACAGG + Intronic
959443910 3:106413342-106413364 CAGGAGGCAATGGATGACACTGG - Intergenic
960966650 3:123110351-123110373 CAGGAGTCCACGGAGCACACAGG - Intronic
968184490 3:196622828-196622850 CTGGAGTCCATGGATTCAAGGGG + Intergenic
969414589 4:7050276-7050298 CAGGAGGCAATGGAATCCATGGG - Intronic
973678028 4:53286227-53286249 CAGGAGTGCAGGTATTCCCCTGG - Intronic
978086501 4:104662165-104662187 CAGGAGTCCATGGATCCAAGAGG - Intergenic
986592882 5:9389642-9389664 GAGGAGGGCATGGATTCCAGAGG - Intronic
988616550 5:32780733-32780755 CAGGTGTCCATAGATGCCAACGG + Exonic
991669326 5:69032103-69032125 CTGGAGTCCATGGATCCCTAAGG - Intergenic
993214786 5:85006250-85006272 CAGTAACCCAAGGATTCCACAGG + Intergenic
993557607 5:89360657-89360679 CTGGAGACCAGGGATGCCACTGG - Intergenic
996628949 5:125604968-125604990 CAGATGTCCAAGGATTCCAAGGG + Intergenic
997209143 5:132067440-132067462 AAGGATTCCATGGACCCCACAGG - Intergenic
1000423735 5:161066371-161066393 CAAGAGTCCATAGTTTACACTGG + Intergenic
1001481620 5:172092794-172092816 AAGGAGGCCATGGCTCCCACTGG + Intronic
1004007918 6:11653848-11653870 CAGGGTTCCATCCATTCCACAGG - Intergenic
1007762541 6:44141474-44141496 CTGGACTCCTTGGAATCCACTGG - Intronic
1009888047 6:69648467-69648489 AAGAAGTCCATGAATTCCAAGGG + Intergenic
1010319026 6:74485231-74485253 CAGGAGCCCATGCAATCAACTGG + Intergenic
1012038895 6:94178345-94178367 CAGGATACAATGGATGCCACAGG + Intergenic
1012407098 6:98912039-98912061 CAGGAGCCCATGCAATCAACTGG + Intronic
1013306345 6:108850236-108850258 CCTGAGTCCATGGTATCCACAGG - Intronic
1015487862 6:133791831-133791853 TAGGATTCCATGGATGCCTCGGG + Intergenic
1018501783 6:164419112-164419134 GGGGAATCCATGGCTTCCACAGG + Intergenic
1023857088 7:44190557-44190579 CAGAAGTCCTTGAATTTCACCGG + Intronic
1023948879 7:44825332-44825354 CAGGAGGCTATGGAGTCTACAGG + Intergenic
1026933448 7:74238063-74238085 CAGGAAACCATGGCTTCCACCGG - Intronic
1027882194 7:83854760-83854782 CAGCTTTCCATGGCTTCCACTGG - Intergenic
1031202880 7:118713029-118713051 AAGGAGACCAATGATTCCACAGG + Intergenic
1034063922 7:148118722-148118744 CAGGAGGCCACGGAGACCACAGG + Intronic
1034222697 7:149458930-149458952 CAGGAGTGGATGGATTCTCCAGG + Intronic
1034859665 7:154584327-154584349 CAGCAGGCCTTGGACTCCACAGG + Intronic
1036015029 8:4773589-4773611 CAGGATACCAAGGATTCCTCAGG + Intronic
1040062169 8:43113389-43113411 CAGGAGTCGATGCAATCAACTGG - Intronic
1041471424 8:58212884-58212906 CAGGAAATCATGGATACCACTGG + Intergenic
1042396635 8:68299077-68299099 CAGAAGTAGGTGGATTCCACAGG + Intergenic
1042522914 8:69733473-69733495 CGGCAGTGAATGGATTCCACGGG + Intronic
1042580061 8:70266906-70266928 AAGGAGTTCATTTATTCCACAGG + Intronic
1046043211 8:108931792-108931814 CAGGAGCCGATGGAATCAACTGG + Intergenic
1048581004 8:135729771-135729793 CAGGAGCCCATGGACTCGATGGG + Intergenic
1049423162 8:142525719-142525741 CAGGGGTCCATGGAGTCCTGGGG + Intronic
1057352886 9:94315470-94315492 CAGGAGGCCATGGCTTCTTCAGG + Intergenic
1057654861 9:96942121-96942143 CAGGAGGCCATGGCTTCTTCAGG - Intronic
1058537095 9:105972855-105972877 CAGGATTCCAAGGATGCCCCAGG - Intergenic
1062682789 9:137791698-137791720 AAGGACTCCATGGACTCTACAGG - Intronic
1193732177 X:85115132-85115154 CAGCAGCCCTTGGATTCCAGAGG + Intergenic
1194814809 X:98429109-98429131 CAGGAGCCGATGGAATCAACTGG - Intergenic
1199853424 X:151740970-151740992 CAGCAGTCCCTGGATACCAATGG + Intronic