ID: 1075738228

View in Genome Browser
Species Human (GRCh38)
Location 10:124677362-124677384
Sequence CCTGGCTGGTGTTCTCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075738228_1075738238 16 Left 1075738228 10:124677362-124677384 CCTCACAGAGAACACCAGCCAGG No data
Right 1075738238 10:124677401-124677423 CGTAAGGAGGAAAGCTGTGCAGG No data
1075738228_1075738234 0 Left 1075738228 10:124677362-124677384 CCTCACAGAGAACACCAGCCAGG No data
Right 1075738234 10:124677385-124677407 AGGGCCAAAAACACCACGTAAGG No data
1075738228_1075738239 19 Left 1075738228 10:124677362-124677384 CCTCACAGAGAACACCAGCCAGG No data
Right 1075738239 10:124677404-124677426 AAGGAGGAAAGCTGTGCAGGAGG No data
1075738228_1075738240 26 Left 1075738228 10:124677362-124677384 CCTCACAGAGAACACCAGCCAGG No data
Right 1075738240 10:124677411-124677433 AAAGCTGTGCAGGAGGCCCACGG No data
1075738228_1075738235 3 Left 1075738228 10:124677362-124677384 CCTCACAGAGAACACCAGCCAGG No data
Right 1075738235 10:124677388-124677410 GCCAAAAACACCACGTAAGGAGG No data
1075738228_1075738241 27 Left 1075738228 10:124677362-124677384 CCTCACAGAGAACACCAGCCAGG No data
Right 1075738241 10:124677412-124677434 AAGCTGTGCAGGAGGCCCACGGG No data
1075738228_1075738242 28 Left 1075738228 10:124677362-124677384 CCTCACAGAGAACACCAGCCAGG No data
Right 1075738242 10:124677413-124677435 AGCTGTGCAGGAGGCCCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075738228 Original CRISPR CCTGGCTGGTGTTCTCTGTG AGG (reversed) Intronic