ID: 1075738233

View in Genome Browser
Species Human (GRCh38)
Location 10:124677380-124677402
Sequence CGTGGTGTTTTTGGCCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075738233_1075738241 9 Left 1075738233 10:124677380-124677402 CCAGGAGGGCCAAAAACACCACG No data
Right 1075738241 10:124677412-124677434 AAGCTGTGCAGGAGGCCCACGGG No data
1075738233_1075738244 15 Left 1075738233 10:124677380-124677402 CCAGGAGGGCCAAAAACACCACG No data
Right 1075738244 10:124677418-124677440 TGCAGGAGGCCCACGGGGCCGGG No data
1075738233_1075738242 10 Left 1075738233 10:124677380-124677402 CCAGGAGGGCCAAAAACACCACG No data
Right 1075738242 10:124677413-124677435 AGCTGTGCAGGAGGCCCACGGGG No data
1075738233_1075738240 8 Left 1075738233 10:124677380-124677402 CCAGGAGGGCCAAAAACACCACG No data
Right 1075738240 10:124677411-124677433 AAAGCTGTGCAGGAGGCCCACGG No data
1075738233_1075738239 1 Left 1075738233 10:124677380-124677402 CCAGGAGGGCCAAAAACACCACG No data
Right 1075738239 10:124677404-124677426 AAGGAGGAAAGCTGTGCAGGAGG No data
1075738233_1075738248 26 Left 1075738233 10:124677380-124677402 CCAGGAGGGCCAAAAACACCACG No data
Right 1075738248 10:124677429-124677451 CACGGGGCCGGGCTTGCGCAGGG No data
1075738233_1075738238 -2 Left 1075738233 10:124677380-124677402 CCAGGAGGGCCAAAAACACCACG No data
Right 1075738238 10:124677401-124677423 CGTAAGGAGGAAAGCTGTGCAGG No data
1075738233_1075738247 25 Left 1075738233 10:124677380-124677402 CCAGGAGGGCCAAAAACACCACG No data
Right 1075738247 10:124677428-124677450 CCACGGGGCCGGGCTTGCGCAGG No data
1075738233_1075738243 14 Left 1075738233 10:124677380-124677402 CCAGGAGGGCCAAAAACACCACG No data
Right 1075738243 10:124677417-124677439 GTGCAGGAGGCCCACGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075738233 Original CRISPR CGTGGTGTTTTTGGCCCTCC TGG (reversed) Intronic