ID: 1075738238

View in Genome Browser
Species Human (GRCh38)
Location 10:124677401-124677423
Sequence CGTAAGGAGGAAAGCTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075738233_1075738238 -2 Left 1075738233 10:124677380-124677402 CCAGGAGGGCCAAAAACACCACG No data
Right 1075738238 10:124677401-124677423 CGTAAGGAGGAAAGCTGTGCAGG No data
1075738228_1075738238 16 Left 1075738228 10:124677362-124677384 CCTCACAGAGAACACCAGCCAGG No data
Right 1075738238 10:124677401-124677423 CGTAAGGAGGAAAGCTGTGCAGG No data
1075738232_1075738238 2 Left 1075738232 10:124677376-124677398 CCAGCCAGGAGGGCCAAAAACAC No data
Right 1075738238 10:124677401-124677423 CGTAAGGAGGAAAGCTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075738238 Original CRISPR CGTAAGGAGGAAAGCTGTGC AGG Intronic