ID: 1075738240

View in Genome Browser
Species Human (GRCh38)
Location 10:124677411-124677433
Sequence AAAGCTGTGCAGGAGGCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075738228_1075738240 26 Left 1075738228 10:124677362-124677384 CCTCACAGAGAACACCAGCCAGG No data
Right 1075738240 10:124677411-124677433 AAAGCTGTGCAGGAGGCCCACGG No data
1075738236_1075738240 -1 Left 1075738236 10:124677389-124677411 CCAAAAACACCACGTAAGGAGGA No data
Right 1075738240 10:124677411-124677433 AAAGCTGTGCAGGAGGCCCACGG No data
1075738232_1075738240 12 Left 1075738232 10:124677376-124677398 CCAGCCAGGAGGGCCAAAAACAC No data
Right 1075738240 10:124677411-124677433 AAAGCTGTGCAGGAGGCCCACGG No data
1075738233_1075738240 8 Left 1075738233 10:124677380-124677402 CCAGGAGGGCCAAAAACACCACG No data
Right 1075738240 10:124677411-124677433 AAAGCTGTGCAGGAGGCCCACGG No data
1075738237_1075738240 -10 Left 1075738237 10:124677398-124677420 CCACGTAAGGAGGAAAGCTGTGC No data
Right 1075738240 10:124677411-124677433 AAAGCTGTGCAGGAGGCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075738240 Original CRISPR AAAGCTGTGCAGGAGGCCCA CGG Intronic