ID: 1075738247

View in Genome Browser
Species Human (GRCh38)
Location 10:124677428-124677450
Sequence CCACGGGGCCGGGCTTGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075738232_1075738247 29 Left 1075738232 10:124677376-124677398 CCAGCCAGGAGGGCCAAAAACAC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1075738247 10:124677428-124677450 CCACGGGGCCGGGCTTGCGCAGG No data
1075738233_1075738247 25 Left 1075738233 10:124677380-124677402 CCAGGAGGGCCAAAAACACCACG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1075738247 10:124677428-124677450 CCACGGGGCCGGGCTTGCGCAGG No data
1075738237_1075738247 7 Left 1075738237 10:124677398-124677420 CCACGTAAGGAGGAAAGCTGTGC 0: 1
1: 0
2: 0
3: 11
4: 69
Right 1075738247 10:124677428-124677450 CCACGGGGCCGGGCTTGCGCAGG No data
1075738236_1075738247 16 Left 1075738236 10:124677389-124677411 CCAAAAACACCACGTAAGGAGGA 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1075738247 10:124677428-124677450 CCACGGGGCCGGGCTTGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075738247 Original CRISPR CCACGGGGCCGGGCTTGCGC AGG Intronic
No off target data available for this crispr