ID: 1075738247

View in Genome Browser
Species Human (GRCh38)
Location 10:124677428-124677450
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075738232_1075738247 29 Left 1075738232 10:124677376-124677398 CCAGCCAGGAGGGCCAAAAACAC No data
Right 1075738247 10:124677428-124677450 CCACGGGGCCGGGCTTGCGCAGG No data
1075738233_1075738247 25 Left 1075738233 10:124677380-124677402 CCAGGAGGGCCAAAAACACCACG No data
Right 1075738247 10:124677428-124677450 CCACGGGGCCGGGCTTGCGCAGG No data
1075738236_1075738247 16 Left 1075738236 10:124677389-124677411 CCAAAAACACCACGTAAGGAGGA No data
Right 1075738247 10:124677428-124677450 CCACGGGGCCGGGCTTGCGCAGG No data
1075738237_1075738247 7 Left 1075738237 10:124677398-124677420 CCACGTAAGGAGGAAAGCTGTGC No data
Right 1075738247 10:124677428-124677450 CCACGGGGCCGGGCTTGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type