ID: 1075741744

View in Genome Browser
Species Human (GRCh38)
Location 10:124700232-124700254
Sequence TGGGAAGCCTGGGGAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075741744_1075741753 24 Left 1075741744 10:124700232-124700254 CCTTTTTTTCCCCAGGCTTCCCA No data
Right 1075741753 10:124700279-124700301 ATTTACCATTCCTATACACACGG No data
1075741744_1075741750 0 Left 1075741744 10:124700232-124700254 CCTTTTTTTCCCCAGGCTTCCCA No data
Right 1075741750 10:124700255-124700277 GTATATGCTAACATTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075741744 Original CRISPR TGGGAAGCCTGGGGAAAAAA AGG (reversed) Intronic
No off target data available for this crispr