ID: 1075741955

View in Genome Browser
Species Human (GRCh38)
Location 10:124701455-124701477
Sequence GGCTGAAGACCAAAGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075741955_1075741961 -9 Left 1075741955 10:124701455-124701477 CCAGCTCCCTTTGGTCTTCAGCC No data
Right 1075741961 10:124701469-124701491 TCTTCAGCCTTAAGGGAGGATGG No data
1075741955_1075741970 29 Left 1075741955 10:124701455-124701477 CCAGCTCCCTTTGGTCTTCAGCC No data
Right 1075741970 10:124701507-124701529 GCGGGCCTGGCCAAGGGAGGTGG No data
1075741955_1075741968 23 Left 1075741955 10:124701455-124701477 CCAGCTCCCTTTGGTCTTCAGCC No data
Right 1075741968 10:124701501-124701523 AGAAGAGCGGGCCTGGCCAAGGG No data
1075741955_1075741967 22 Left 1075741955 10:124701455-124701477 CCAGCTCCCTTTGGTCTTCAGCC No data
Right 1075741967 10:124701500-124701522 AAGAAGAGCGGGCCTGGCCAAGG No data
1075741955_1075741962 -8 Left 1075741955 10:124701455-124701477 CCAGCTCCCTTTGGTCTTCAGCC No data
Right 1075741962 10:124701470-124701492 CTTCAGCCTTAAGGGAGGATGGG No data
1075741955_1075741969 26 Left 1075741955 10:124701455-124701477 CCAGCTCCCTTTGGTCTTCAGCC No data
Right 1075741969 10:124701504-124701526 AGAGCGGGCCTGGCCAAGGGAGG No data
1075741955_1075741965 11 Left 1075741955 10:124701455-124701477 CCAGCTCCCTTTGGTCTTCAGCC No data
Right 1075741965 10:124701489-124701511 TGGGCTGCAGAAAGAAGAGCGGG No data
1075741955_1075741964 10 Left 1075741955 10:124701455-124701477 CCAGCTCCCTTTGGTCTTCAGCC No data
Right 1075741964 10:124701488-124701510 ATGGGCTGCAGAAAGAAGAGCGG No data
1075741955_1075741966 16 Left 1075741955 10:124701455-124701477 CCAGCTCCCTTTGGTCTTCAGCC No data
Right 1075741966 10:124701494-124701516 TGCAGAAAGAAGAGCGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075741955 Original CRISPR GGCTGAAGACCAAAGGGAGC TGG (reversed) Intronic
No off target data available for this crispr