ID: 1075742738

View in Genome Browser
Species Human (GRCh38)
Location 10:124705756-124705778
Sequence GACCTAGGTCTATCTGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075742734_1075742738 -8 Left 1075742734 10:124705741-124705763 CCTGCCACAGCCAGAGACCTAGG 0: 1
1: 1
2: 3
3: 25
4: 252
Right 1075742738 10:124705756-124705778 GACCTAGGTCTATCTGCTCAAGG No data
1075742732_1075742738 0 Left 1075742732 10:124705733-124705755 CCCAAGCTCCTGCCACAGCCAGA 0: 1
1: 0
2: 4
3: 28
4: 364
Right 1075742738 10:124705756-124705778 GACCTAGGTCTATCTGCTCAAGG No data
1075742733_1075742738 -1 Left 1075742733 10:124705734-124705756 CCAAGCTCCTGCCACAGCCAGAG No data
Right 1075742738 10:124705756-124705778 GACCTAGGTCTATCTGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075742738 Original CRISPR GACCTAGGTCTATCTGCTCA AGG Intronic
No off target data available for this crispr