ID: 1075742999

View in Genome Browser
Species Human (GRCh38)
Location 10:124707057-124707079
Sequence TGGCATGGCAGGGGTGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 889
Summary {0: 1, 1: 1, 2: 6, 3: 79, 4: 802}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075742999_1075743012 5 Left 1075742999 10:124707057-124707079 CCCCGCCCACCCCTGCCATGCCA 0: 1
1: 1
2: 6
3: 79
4: 802
Right 1075743012 10:124707085-124707107 GGGCTGCCTCACTTGTAAAATGG 0: 1
1: 0
2: 0
3: 54
4: 416
1075742999_1075743017 30 Left 1075742999 10:124707057-124707079 CCCCGCCCACCCCTGCCATGCCA 0: 1
1: 1
2: 6
3: 79
4: 802
Right 1075743017 10:124707110-124707132 TGGTGGATAGAACAACAAATTGG No data
1075742999_1075743015 13 Left 1075742999 10:124707057-124707079 CCCCGCCCACCCCTGCCATGCCA 0: 1
1: 1
2: 6
3: 79
4: 802
Right 1075743015 10:124707093-124707115 TCACTTGTAAAATGGCCTGGTGG No data
1075742999_1075743013 10 Left 1075742999 10:124707057-124707079 CCCCGCCCACCCCTGCCATGCCA 0: 1
1: 1
2: 6
3: 79
4: 802
Right 1075743013 10:124707090-124707112 GCCTCACTTGTAAAATGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075742999 Original CRISPR TGGCATGGCAGGGGTGGGCG GGG (reversed) Intronic
900127171 1:1073763-1073785 TGGCAAGTCAGGGGTGGGGCGGG - Intronic
900145490 1:1157331-1157353 GGGGATGGGATGGGTGGGCGGGG - Intergenic
900161013 1:1223803-1223825 TGGCTGGGCCGGGGTGGGTGGGG - Intronic
900218678 1:1495673-1495695 CGGCAAGGCAGGGGTAGGAGGGG - Exonic
900226033 1:1534114-1534136 CGGCAAGGCAGGGGTGGGAGGGG - Exonic
900299330 1:1969211-1969233 GGGCAGGGCAGGGCTGGGCAGGG - Intronic
900299374 1:1969326-1969348 GGGCAGGGCAGGGCTGGGCAAGG - Intronic
900482248 1:2905007-2905029 GGGCAGGGCAGGGCGGGGCGGGG - Intergenic
900626852 1:3612220-3612242 TGGCCTGGAGTGGGTGGGCGCGG + Intergenic
900647116 1:3714009-3714031 TGGCATGGCTGGGGGAGGGGTGG - Intronic
900749869 1:4388695-4388717 TGGAATGGGGGAGGTGGGCGTGG + Intergenic
900965146 1:5952560-5952582 GGGCAGGGTAGGGGTGGGTGGGG - Intronic
900965156 1:5952580-5952602 GGGCAGGGTAGGGGTGGGTGGGG - Intronic
900965166 1:5952600-5952622 GGGCAGGGTAGGGGTGGGTGGGG - Intronic
901011987 1:6207305-6207327 TGGAATGTGAGGGGTGGGGGTGG + Intronic
901018305 1:6243888-6243910 GGGCATGGAGGGGGTGGGCATGG + Intergenic
901180218 1:7336546-7336568 TGTGATTGCAGGGGTGGGCAGGG + Intronic
901438083 1:9261722-9261744 TGGCCAGGCAGGGCGGGGCGAGG + Intronic
901604739 1:10450267-10450289 GGGCAGGGCAGCGGTGGCCGTGG - Exonic
901797492 1:11688929-11688951 TGCCATGGCACTGGTGGGAGTGG - Intronic
902232379 1:15036255-15036277 AGGCAGGGCAGGGGAGGGCTGGG - Intronic
902232417 1:15036358-15036380 AGGCAGGGCAGGGGAGGGCTGGG - Intronic
902435859 1:16397803-16397825 GGGCAGGGCAGGGCTGGGCGGGG - Exonic
903028630 1:20447054-20447076 TTGGATAGCAGAGGTGGGCGGGG - Intergenic
903189662 1:21649673-21649695 TGGCATCGCAGGGGTAGGAATGG + Intronic
903307588 1:22424183-22424205 TGCTGTGGCAGGGGTGGGAGGGG - Intergenic
903536248 1:24068180-24068202 GGGCGGGGCAGGGCTGGGCGGGG + Intronic
903575378 1:24336628-24336650 TGCCTTGCCAGGGGTGGGCAAGG - Exonic
903672835 1:25046649-25046671 GGGCCTGGGAGGGGTGGGCCTGG - Intergenic
903792617 1:25905630-25905652 GGGAAGGGGAGGGGTGGGCGGGG + Intronic
903811555 1:26037604-26037626 TGCCATGGCTTGGGTGGGGGTGG + Intronic
903959293 1:27046698-27046720 AGGCAGGGCAGGGGTGGGGGGGG - Intergenic
904079504 1:27863081-27863103 TGGCTTGGCAGGGCAGGGAGGGG - Intergenic
904295277 1:29516265-29516287 TGGAATGGCAGGCGTGGGGCTGG + Intergenic
904335030 1:29791420-29791442 TGGAATGGCAGGTGTGGGGCTGG + Intergenic
904359184 1:29961137-29961159 TGGCGGGGCCAGGGTGGGCGTGG - Intergenic
904533777 1:31185874-31185896 TGGCATTGCAGTGGTGAGCCAGG - Intronic
904603715 1:31687540-31687562 TACTATGGCAGTGGTGGGCGTGG + Intronic
905149906 1:35919418-35919440 TGGCATCCCAGGGCTGGGCGAGG + Intronic
905182997 1:36178145-36178167 GGGCGGGGCTGGGGTGGGCGAGG - Exonic
905874278 1:41422352-41422374 TGGCATGGGTGGGGTTGGCTGGG + Intergenic
906117906 1:43367827-43367849 GGGCAGGGCAGGGCTGGGCCGGG + Intronic
906128501 1:43442135-43442157 GGGCATGGCCCGGGGGGGCGGGG + Intronic
906203731 1:43975842-43975864 TGGCATGGTAAGGGAGGGCAGGG + Exonic
906264965 1:44421630-44421652 GGGGAGGGCAGGGTTGGGCGGGG + Intronic
906525878 1:46493068-46493090 TGGGAAGGCAGGGGTGGGGGAGG - Intergenic
908115556 1:60936740-60936762 TGGAATGGGAGGGGAGGGCTTGG - Intronic
910387284 1:86698753-86698775 TGGCATTGTAGGGCCGGGCGCGG + Intergenic
911239101 1:95446089-95446111 TGGCTTGGAAGGGTTGGGAGTGG - Intergenic
912687653 1:111779691-111779713 TGACTGGGCAGGGGTGGGGGTGG + Intronic
913165597 1:116181801-116181823 TGGTCTGGCAGGGGAGTGCGCGG - Intergenic
913972092 1:143423371-143423393 GGGCATGGCGGGGGAGGGTGGGG + Intergenic
914066473 1:144248984-144249006 GGGCATGGCGGGGGAGGGTGGGG + Intergenic
914112680 1:144717370-144717392 GGGCATGGCGGGGGAGGGTGGGG - Intergenic
914662916 1:149807503-149807525 AGGCATGGCGGGGGGGGGGGGGG + Intronic
914944446 1:152051548-152051570 TGGCAGGGGAGGGGTGGGGAGGG + Intergenic
915229447 1:154434775-154434797 TGGCAGGGAAGGGGTGGTTGAGG + Intronic
915264247 1:154704567-154704589 AGCAATGGCAGGGGTGGGGGTGG + Exonic
915381067 1:155441302-155441324 TGGCGGGGCCGGGGTGGGAGTGG - Intronic
915579956 1:156807644-156807666 TGGCATGGCAGGTGTGTGTAAGG + Intronic
915629682 1:157142619-157142641 TGGGAAGGCAGGGGTGGGGGTGG - Intergenic
916063898 1:161120793-161120815 TGGCAGGGTGGGGGTGGGAGGGG - Exonic
916142475 1:161711495-161711517 TGTCATGGCAGGGGAGGGTAAGG + Intronic
917110340 1:171541088-171541110 GGGCGTGGCAGGGGTGGTAGGGG + Exonic
917152958 1:171964452-171964474 TGGAAAGGCAGGGGTGGAGGGGG - Intronic
917650371 1:177070746-177070768 TAGAATGGTAGGGGTGGGAGTGG + Intronic
917733310 1:177897804-177897826 GGGCATGGCAGGGCTGGGACTGG - Intergenic
918239550 1:182609640-182609662 GGTGATGGCAGGGGTGGGCAGGG - Intergenic
919501168 1:198339794-198339816 TGGCATGGCATTTGTGGGCAAGG + Intergenic
919664895 1:200282594-200282616 TGGCAGGGCTGGGCTGGGCTGGG - Intergenic
919664897 1:200282599-200282621 GGGCTTGGCAGGGCTGGGCTGGG - Intergenic
919748143 1:201021336-201021358 TGGGAGGGGAGGAGTGGGCGGGG + Intronic
919915158 1:202134385-202134407 GGGGACGACAGGGGTGGGCGGGG + Exonic
920167134 1:204043966-204043988 TGGCATGGCAGGCCGGGGGGTGG - Intergenic
920367973 1:205457904-205457926 TGTCATGGCACGGGTGGTGGGGG - Intergenic
920657198 1:207885936-207885958 TGGCCTGGTAGGGGTGGGGTGGG + Intronic
920854492 1:209651864-209651886 TGGCAAGGCAGGGGCGGGGGGGG + Intronic
920859005 1:209689654-209689676 TGGCAAGAGAGGGGTGGGAGGGG - Intronic
921326110 1:213987698-213987720 TGGCAGGGTGGGGGTGGGGGTGG + Intronic
921332210 1:214050666-214050688 GGTCAGGGCAGGTGTGGGCGTGG - Intergenic
921712525 1:218387226-218387248 CAGTATGGCAGGGGTGGGAGGGG + Intronic
921926576 1:220714948-220714970 TGGCATGCCAGGAGAGGGCATGG - Intergenic
922237259 1:223731468-223731490 TAGGAGGGCTGGGGTGGGCGAGG - Intronic
922280654 1:224120570-224120592 TGTCATTGTAGGGCTGGGCGTGG + Intronic
922645382 1:227281327-227281349 TGGCATGTCTGGGGTGAGAGTGG - Intronic
922705479 1:227788212-227788234 TGGGATGGGAGGGGAGGGAGTGG + Intergenic
923871273 1:237996506-237996528 GGGAATGGGAGGGGTGGGGGAGG + Intergenic
924071522 1:240285176-240285198 TGGGGTGGTAGGGGTGGGTGTGG + Intronic
924092964 1:240521276-240521298 TGAAACGGGAGGGGTGGGCGCGG + Intronic
1062892506 10:1074638-1074660 TGGCATGGTAGGTGTGAGGGGGG + Intronic
1063425286 10:5945849-5945871 CGGCAAGGCAGGGGTTGGCCGGG - Intronic
1064008100 10:11714070-11714092 TGGCATGGCAGGGAGTGACGGGG + Intergenic
1064125678 10:12658313-12658335 GTGCATGGCTGGGGAGGGCGGGG + Intronic
1065023584 10:21520470-21520492 GGGAATGGCGGGGGTGGGGGTGG - Intronic
1065550760 10:26866691-26866713 TGGGGTGGCAGGGGTTGGGGAGG - Intergenic
1065758403 10:28957285-28957307 GGGCCTGTCAGGGGTGGGAGTGG + Intergenic
1065963523 10:30753101-30753123 TGGCCTGGCTGGGGTGGGCAGGG - Intergenic
1066611933 10:37257955-37257977 TGGCTTGTCAGGGGTTGGAGGGG + Intronic
1066728236 10:38412881-38412903 TGGTAGGGAAGGGGTGGGGGTGG + Intergenic
1067256549 10:44647663-44647685 GGGCAAGGCAGGGATGGGCAGGG - Intergenic
1067295488 10:44973149-44973171 TGGGATGGCAGGAGAGGGAGGGG - Intronic
1068380514 10:56248001-56248023 TGGCATGGAAGGGTTGGAAGAGG + Intergenic
1068867868 10:61914039-61914061 TGTCATTCCAGGGCTGGGCGCGG - Intronic
1069168061 10:65188535-65188557 TGGAATAGCAGGGGTGAGAGAGG + Intergenic
1069357695 10:67606612-67606634 TGGCAAGGCAGGGGAGGAAGAGG + Intronic
1069782090 10:70963248-70963270 TTGGATGGCAGGGGTGGGGAGGG + Intergenic
1070566073 10:77604883-77604905 TGACAAGGAAGGGGTGGGGGAGG - Intronic
1070570896 10:77638554-77638576 GGGCTGGGCAGGGGTGGGCAGGG + Intronic
1070748096 10:78947296-78947318 TGGGCTGGCAGGGGAGGGCGAGG - Intergenic
1070793798 10:79205283-79205305 GGGCAGGGCAGGGGTGAGCTTGG - Intronic
1070796785 10:79221543-79221565 TGGCATGGAAGGTGGGGGTGGGG - Intronic
1071219050 10:83442037-83442059 TGGGGTGGCAGGAGTGGGCAGGG + Intergenic
1071397710 10:85239474-85239496 TGGCATGGCAGGGGAGCTCATGG - Intergenic
1072559203 10:96554659-96554681 TGGGATGGGAGGTGGGGGCGAGG - Intronic
1072631600 10:97150585-97150607 GGGCCTGGAAGGGGTGGGGGTGG - Intronic
1074703996 10:116115485-116115507 GGGCAGGGCAGGGCTGGGCTGGG - Intronic
1074745043 10:116524045-116524067 TGGCAGGGGAGGGCCGGGCGCGG + Intergenic
1075714752 10:124549737-124549759 GGGCATGGCCGGGGTGGGCATGG + Intronic
1075742999 10:124707057-124707079 TGGCATGGCAGGGGTGGGCGGGG - Intronic
1076670347 10:132117580-132117602 TGGGCAGGCAGGGGCGGGCGTGG + Intronic
1076737484 10:132465300-132465322 TGGCAGGGCAGGGTGGGGCGGGG - Intergenic
1076781760 10:132728490-132728512 TGGCTTGGCGGGGGTGGAGGAGG - Intronic
1076813278 10:132899970-132899992 TCACATGGCAAGGGTGGGAGTGG + Intronic
1076909338 10:133379379-133379401 CGGCATCGCGGGGCTGGGCGCGG + Exonic
1077015383 11:396953-396975 GGGCATGGGAGGGGTGGGCTGGG - Exonic
1077073726 11:690263-690285 GGGCAGGGCAGGGGAGGGCAGGG + Intronic
1077095373 11:796938-796960 TGGGGCGGCAGGGGTGGGGGGGG - Intronic
1077104471 11:836182-836204 TGGCCCGGGAGGGGTGGGGGTGG - Intronic
1077142310 11:1030000-1030022 TGGGTTTGCAGGGGTGGCCGTGG + Intronic
1077154562 11:1085620-1085642 TGGCTGGGGAGGGGTGGCCGGGG - Intergenic
1077278564 11:1730429-1730451 AGGCTTTGCAGGGGTGGTCGGGG - Intergenic
1077301559 11:1849635-1849657 TGGACTGGCAGGCGTGGGCAAGG - Intergenic
1077307762 11:1875662-1875684 GGGCATGGCAGGGGAGGGTGGGG - Intronic
1077331812 11:1987268-1987290 GGGCAGGGCAGGGCTGGGCTGGG + Intergenic
1077331855 11:1987388-1987410 GGGCAGGGCAGGGCTGGGCTGGG + Intergenic
1077509336 11:2948045-2948067 TGGCATGGGAGGGGTGGCGTGGG + Intronic
1077868959 11:6245431-6245453 TGTCATGGTAGGGCTGGGCCAGG - Intergenic
1078238190 11:9505514-9505536 TTGCATATCAGGGCTGGGCGTGG - Intronic
1078442129 11:11377061-11377083 GGGGATGACAGGGGTGGGCAGGG - Intronic
1078666594 11:13331045-13331067 AGTCATGGCAGAGGTGGGCTGGG + Intronic
1078914115 11:15761777-15761799 TTGCAGGGCAGGGGTGGGGGTGG - Intergenic
1079095964 11:17510259-17510281 TGGGGTGGTAGGGGTGGGCCTGG + Intronic
1080749599 11:35139752-35139774 AGGCAGGGCAGAGCTGGGCGGGG + Intronic
1080815476 11:35752345-35752367 TGGAATGGCAGTGGGGGTCGGGG - Intronic
1080841391 11:35986571-35986593 TTGGATGGCAGTAGTGGGCGAGG + Intronic
1080887652 11:36381437-36381459 GGGCAGGGTAGGGGTGGGTGGGG + Intronic
1081570428 11:44287182-44287204 TGCAATGGCAGGGGTGAGTGGGG + Intronic
1081758639 11:45561794-45561816 TGGGATGACAGGGGTGTGCCTGG + Intergenic
1081763030 11:45590505-45590527 GGGCATGGCAGGGGAGGTGGAGG - Intergenic
1081977305 11:47243844-47243866 ATGAATGGCAGGGCTGGGCGTGG + Intronic
1083294518 11:61707860-61707882 TGGCAGGGCTGGGCAGGGCGGGG + Intronic
1083299736 11:61734161-61734183 TGCCAGGGCAGGGGTAGGGGAGG + Intronic
1083571891 11:63765513-63765535 AGGCCTGGCTGGGGTGGGTGAGG - Intronic
1083587776 11:63872897-63872919 TGGCAGGGTGGGGGTGGGGGTGG - Intronic
1083881950 11:65553271-65553293 TAGCTTGGCAGGGGAGGGTGAGG + Intronic
1083891056 11:65595883-65595905 TGGGATGGCTGGGGTGGCTGGGG + Exonic
1084006656 11:66326806-66326828 TCGCCTGGCAGGGCTGTGCGGGG + Intergenic
1084106912 11:66986260-66986282 TGGCCTGGCTGGGGTGGGACAGG - Intergenic
1084174674 11:67417132-67417154 CAGCATGGCAGGGGCGGGAGGGG + Intronic
1084270005 11:68023749-68023771 AGTGATGGCAGGGCTGGGCGCGG + Intronic
1084427602 11:69094157-69094179 GGGCTTGGCAGGGCTGGGCAGGG + Intergenic
1084611675 11:70207030-70207052 AGGCATGGCTGGGGTGGGGGTGG + Exonic
1084761336 11:71273410-71273432 TGGAATGGCAGGGTGGGGTGGGG - Intergenic
1085098371 11:73779464-73779486 TGGCTTGACAGGGGAGGGTGGGG - Intergenic
1085472634 11:76767998-76768020 TGGCCTGGCCAGGGTGGCCGTGG - Intergenic
1086227098 11:84525314-84525336 TAGAATGGCAGGGGAGGGAGTGG - Intronic
1087060135 11:93969340-93969362 TGGGATAGCAGGGGTGGGAGAGG - Intergenic
1088205500 11:107387616-107387638 TGGCAGGGCAGTGGTGGGGGTGG + Intronic
1089001034 11:115052650-115052672 TGGCATGGCTGGGGTAGTTGGGG - Intergenic
1089164508 11:116464854-116464876 TGGCATGGTGGGGGTGGTGGGGG - Intergenic
1089249120 11:117144739-117144761 GGGCAGGGCAGGGCGGGGCGGGG - Intronic
1089249123 11:117144744-117144766 GGGCAGGGCAGGGCAGGGCGGGG - Intronic
1089337571 11:117735486-117735508 GGGCGGGGCAGGGGTGGGCGGGG + Intronic
1089383856 11:118055429-118055451 TGGCAGGGCCGGGGTGGTGGTGG - Intergenic
1089557253 11:119321244-119321266 TGGCAGAGCTGGGGTGGGCGCGG + Intronic
1090086120 11:123652761-123652783 GTGTATGGCAGGGGTGGGGGTGG - Intronic
1090403390 11:126463120-126463142 TGGCAGGGCTGGGTTGGGGGAGG + Intronic
1090664211 11:128904280-128904302 TGGCTTGTCTGGGGTGGGCGAGG - Intronic
1090699438 11:129280187-129280209 TGGCATGGCAGGGGAGAGAAAGG + Intergenic
1202814793 11_KI270721v1_random:42444-42466 GGGCAGGGCAGGGCTGGGCTGGG + Intergenic
1202814836 11_KI270721v1_random:42564-42586 GGGCAGGGCAGGGCTGGGCTGGG + Intergenic
1091490420 12:927574-927596 TGGGATGGCCGGGCCGGGCGTGG + Intronic
1091673231 12:2467662-2467684 GGGCAGGGCGGGGCTGGGCGTGG - Intronic
1091686769 12:2567863-2567885 TGGCAAGGCCTGGGTGGGAGGGG + Intronic
1091752265 12:3030357-3030379 ATGCATGGGAGGGGTGGGCCTGG + Intronic
1091753287 12:3035955-3035977 TGGCATGGCAGAGGTGGCTGAGG - Intronic
1091917805 12:4281946-4281968 AGGCATGGGTGGGTTGGGCGGGG + Intronic
1092007096 12:5078877-5078899 TGGGATGGCAGGAGTGGTCTGGG - Intergenic
1092172896 12:6384464-6384486 GGGCCTGGTAGGAGTGGGCGAGG + Intronic
1092944652 12:13441486-13441508 TGGCATGGCTGTGCTGGGAGAGG + Intergenic
1093072564 12:14722050-14722072 TGTCAAGGAAGGGCTGGGCGCGG - Intergenic
1094132921 12:27094228-27094250 TGGCATGGAGGGTGTGGGCTGGG + Intergenic
1094494241 12:30979507-30979529 TGCCAGGGCAGGGGTGGGGCTGG + Intronic
1094841519 12:34344465-34344487 AGGCCTGGAAGGGGTGGCCGAGG - Intergenic
1095772034 12:45970440-45970462 TGTCATGGCAGGATTGGGCTTGG - Intronic
1095951099 12:47782438-47782460 TGATATGGCAGGAGTGGGGGTGG - Exonic
1096096505 12:48938900-48938922 AGGTATGTCAGGGGTGGGTGGGG + Exonic
1096106576 12:48999559-48999581 TGGGATCGCACGAGTGGGCGGGG + Intergenic
1096183736 12:49565319-49565341 TGCAATGGCAGGGTTGGGGGTGG + Intronic
1096579615 12:52576168-52576190 AGGCATGGCAGCTGTGGGCTGGG + Intergenic
1096713408 12:53475144-53475166 TGGCACGGCAGAGGTGGTGGTGG - Intronic
1096791558 12:54048079-54048101 AGGCTTGGAAGGGGTGTGCGAGG + Intronic
1097050795 12:56221933-56221955 TTGCGTAGCAGCGGTGGGCGGGG - Intronic
1097938493 12:65278904-65278926 TGGCAGGGTCGGGGTGGGAGGGG - Intronic
1098520677 12:71432025-71432047 TGGCCTGGCAAGGGTAGGGGTGG + Intronic
1100247937 12:92782948-92782970 TGGCATGCCCGGGGAGGGCACGG + Intronic
1101731202 12:107428034-107428056 TGGCTTGGCAGGGCTGGACCTGG - Intronic
1102057213 12:109905531-109905553 TGGGCTGGCAGGGGAGGGGGTGG + Intronic
1102163651 12:110788977-110788999 TGGCCTGGCTGGTGTGGGCATGG - Intergenic
1102520784 12:113476564-113476586 AGGGATGGCGGGGGTGGGAGTGG + Intergenic
1103363893 12:120368984-120369006 TGGCGGGGCCGGGGCGGGCGCGG + Intronic
1103557486 12:121775235-121775257 TGGGATGGCAGATGTGGGGGTGG + Intronic
1103901103 12:124303960-124303982 TGGCAAGGCAGGGGAGGGCCAGG - Intronic
1104067937 12:125320532-125320554 TGGCATTGCTGGGGTGAGCTTGG + Intronic
1104596955 12:130126383-130126405 GGGAAGGGCAGGGGTGGGGGTGG + Intergenic
1104633370 12:130423298-130423320 TGGCAGGGCAGGGGAGGCTGCGG + Intronic
1104764069 12:131315230-131315252 TGACATGGCAGAGGTGTGGGTGG + Intergenic
1104815486 12:131643125-131643147 TGACATGGCAGGGGTGTGAGTGG - Intergenic
1104846644 12:131850391-131850413 TGGCAGGGCTGGGGCCGGCGAGG - Intronic
1104861864 12:131928232-131928254 AGGCAAGGAAGTGGTGGGCGCGG + Intergenic
1104933869 12:132354329-132354351 GGGCTGGGCAGGGGTGGTCGGGG + Intergenic
1105472262 13:20704329-20704351 GGGGAGGGCAGGGCTGGGCGGGG + Intronic
1105738368 13:23295929-23295951 TGGTGTGGGATGGGTGGGCGAGG - Intronic
1106088276 13:26562378-26562400 TGACATGACAGGGATGGGAGGGG + Intronic
1106372177 13:29145664-29145686 TGGGGTGGCAGGGGTGGGTGGGG - Intronic
1106827930 13:33544255-33544277 TGGCACGGTAGGGATGGGAGTGG - Intergenic
1107958547 13:45540129-45540151 TGGCTTGGCAGGGGTGGACGAGG + Intronic
1108382051 13:49863823-49863845 TGACATGGCAGGAGTTGGGGAGG + Intergenic
1110976890 13:81849110-81849132 TGGCCTGTGAGGGGTGGGGGTGG - Intergenic
1112278981 13:98046153-98046175 TGGGCTGGCAGAGGTGGGGGTGG + Intergenic
1114189215 14:20428352-20428374 AGGCATCCCAGGGGTGGGAGAGG + Intergenic
1114318241 14:21526021-21526043 GGGCTGGGCAGGGGTGGGGGCGG - Intronic
1115873289 14:37831075-37831097 TTGGCTGGGAGGGGTGGGCGAGG - Intronic
1116872571 14:50082346-50082368 TGGCAAGGTTGGGGTGGGCGGGG - Intergenic
1119073370 14:71609876-71609898 TGGCAGGGCAGGGTGGGGTGGGG - Intronic
1119148120 14:72334375-72334397 TGGCAGGGCAGGGGGTGGGGAGG + Intronic
1119160803 14:72451116-72451138 TGGCATGGAAGGGATGGTGGCGG + Intronic
1119406265 14:74401592-74401614 TGGCTTGGTAGGGGTGGGGCAGG - Intergenic
1119425527 14:74532395-74532417 TGGCAGGGATGGGGTGGGGGTGG - Intronic
1119474845 14:74921239-74921261 GGGCAGGGCTGGGGTGGGTGGGG - Intronic
1119535888 14:75402116-75402138 TGGGCTGGAAGGGGTGGGTGTGG - Intergenic
1119773973 14:77237272-77237294 GGGCCTAGCAGGGGTGGGCAGGG - Intronic
1120135602 14:80865078-80865100 GGGCAGGGCAGGGTTGGGAGGGG - Intronic
1121262122 14:92574029-92574051 CTTCATGGCAGGGGTGGGGGTGG - Intronic
1121326949 14:93025999-93026021 TGGGATGACAGGCGTGGGCGTGG - Intronic
1121565544 14:94906827-94906849 CTGCTTGGCAGGGGTGGGCGGGG + Intergenic
1121614381 14:95303394-95303416 TGGCGTGGCAGGGGTGGGCGTGG - Intronic
1121914469 14:97824077-97824099 TGGAATGGCAGAGGTGGAAGCGG + Intergenic
1122038473 14:98965094-98965116 TGGCCTGGGTGGGGTGGCCGTGG - Intergenic
1122076070 14:99235409-99235431 TGGCATGGGGGGAGGGGGCGCGG - Intronic
1122158195 14:99763848-99763870 TTGCATGGCAGAGGTGGGTTTGG - Intronic
1122183299 14:99971331-99971353 GGGCGTGGCCGGGGTGGGGGCGG - Intergenic
1122297358 14:100712994-100713016 TGGCATGGCCGTGGTGAGCTGGG - Intergenic
1122417036 14:101554994-101555016 GGGCAGGGCAGGGTGGGGCGGGG - Intergenic
1122546821 14:102527714-102527736 GGGCAGGGCAGGGCTGGGCGTGG + Intergenic
1122605941 14:102947862-102947884 GGGCAGGGCAGGGCAGGGCGTGG - Intronic
1122605942 14:102947867-102947889 TGGCAGGGCAGGGCAGGGCAGGG - Intronic
1122666105 14:103331122-103331144 TGGCGCGGGAGGGGTGGGGGGGG - Intergenic
1122885190 14:104707642-104707664 AGGCCTGGCAGGGGTGGGGGCGG - Exonic
1122924943 14:104895159-104895181 GGGCGAGGCAGGGGTGGGGGTGG - Exonic
1122976403 14:105172666-105172688 TGGCATGGCAGGCCTGGGGGTGG - Intergenic
1122996750 14:105269226-105269248 CGGCAAAGCAGGGGTGGGCTGGG + Intronic
1123420165 15:20124854-20124876 CAGCATGACAGGGGTGGGCAGGG + Intergenic
1123445697 15:20328678-20328700 CAGCATGACAGGGGTGGGCAGGG - Intergenic
1123529388 15:21131390-21131412 CAGCATGACAGGGGTGGGCAGGG + Intergenic
1123538503 15:21262368-21262390 TGCGGTGGCAGGGGTGGTCGGGG - Intergenic
1123756471 15:23401041-23401063 TGGGATGGTGGGGGTGGGTGTGG + Intergenic
1123909872 15:24955824-24955846 AGGCATGGCGGCGGTGGGCATGG + Intronic
1123909878 15:24955844-24955866 TGGCATGGAGGCGGTGGGCATGG + Intronic
1123976400 15:25558352-25558374 TGGAAAGGCAGTGGTGGGCCTGG + Intergenic
1124035324 15:26048997-26049019 TGGCATGTGTGGGGTGGGAGGGG - Intergenic
1124342017 15:28895657-28895679 TGGCATGGCATGGGGGTGGGGGG + Intronic
1124641122 15:31397257-31397279 GGGCAGGGCAGGGGTGCACGTGG + Intronic
1125533628 15:40429713-40429735 TGGGAGGGCAGGAGTGGGCAGGG + Intronic
1125719518 15:41838639-41838661 TGGGATTGCAGGGCTGGGTGGGG + Intronic
1126066641 15:44830721-44830743 GGGCCTGGCAGGGCTGGGCCTGG + Intergenic
1126093241 15:45070148-45070170 GGGCCTGGCAGGGCTGGGCCTGG - Intronic
1126823662 15:52528912-52528934 GGGCAGGGCAGGGCCGGGCGGGG + Exonic
1127165781 15:56243828-56243850 TGGCAGGGCAGCGGCGGCCGCGG - Intergenic
1127446632 15:59069975-59069997 TGGTGTGGCAGGGGTGGGTAGGG - Intronic
1127770153 15:62224351-62224373 AGGCAGGGCAGGGGAGGGCAGGG - Intergenic
1127771994 15:62239822-62239844 GTGCAAGGCTGGGGTGGGCGGGG + Intergenic
1128043973 15:64600655-64600677 AGGGATGGCGGGGGTGGGGGCGG + Intronic
1128054430 15:64689237-64689259 TGGGTTGGTAGGGGTGGGGGTGG - Intronic
1128119456 15:65134790-65134812 TGGCATGCAAGGGGTGGGGAGGG - Intergenic
1128606916 15:69043499-69043521 TGGCAAGGTAGGGTTGGGCCAGG - Intronic
1128640502 15:69332685-69332707 TGGGTTGGCCGGGGTGGGGGTGG - Intronic
1128698854 15:69789304-69789326 TGGCTTGGTAGGGGTGTGGGAGG + Intergenic
1128706239 15:69839199-69839221 TGGCATGAGAGGGGTGAGGGTGG + Intergenic
1128738269 15:70065965-70065987 GGGCGGGGCAGGGGTGGGCATGG - Intronic
1128995141 15:72289773-72289795 GGGCAGGGCAGGGGAGGCCGTGG + Intronic
1129107945 15:73322166-73322188 GGGCTGGGCAGGGGTGGGAGTGG - Exonic
1129709186 15:77811551-77811573 TTGCTGGGCAGGGGTGGGTGGGG + Intronic
1129709867 15:77815291-77815313 TTGCTGGGCAGGGGTGGGTGGGG - Intronic
1130584978 15:85173775-85173797 TGGCAGGGCTGGGCTGGCCGGGG + Intergenic
1131800658 15:96066065-96066087 TGCCATGCGAGGGGTGGGAGAGG + Intergenic
1132144970 15:99424332-99424354 GGGCAGGGCAGGGGTGGAGGTGG + Intergenic
1132431670 15:101766254-101766276 TGGGAGGGCAGGGGTGGGGAGGG - Intergenic
1132555117 16:568874-568896 TGGCTGGGCTGGGCTGGGCGGGG + Exonic
1132571152 16:644728-644750 AGGCAGGGCAGGGCCGGGCGCGG - Intronic
1132623349 16:878711-878733 TGCTCTGGCAGGGGTGGGCAGGG + Intronic
1132634803 16:938438-938460 GGGGATGGCAGGGGTGGGGCTGG + Intronic
1132741389 16:1414870-1414892 GGGCAGGGCAGGGCGGGGCGCGG - Intergenic
1132741390 16:1414875-1414897 GGGCAGGGCAGGGCAGGGCGGGG - Intergenic
1132837092 16:1959608-1959630 CGGCATGGCGGCGGCGGGCGCGG - Exonic
1132884995 16:2178693-2178715 TGTCCTGGTCGGGGTGGGCGTGG - Intronic
1132993453 16:2810116-2810138 TGGGAGGCCAGGGGTGGGGGTGG - Intergenic
1133235956 16:4387548-4387570 TGGCAGGGTGGGGGTGGGGGTGG - Intronic
1133331024 16:4974072-4974094 TGGGGTGGCAGGGGAGGGGGCGG + Intronic
1133725978 16:8537967-8537989 TGTCATGGCAGGGGTGGGTGGGG + Intergenic
1133877002 16:9744434-9744456 GAGCATGCCAGGGGTGGGCATGG + Intergenic
1134776766 16:16859918-16859940 GGGCCTGTCAGGGGTGGGCTAGG - Intergenic
1136066346 16:27761468-27761490 TGGCCTGGAAGTGGTGGGCAAGG + Exonic
1136089129 16:27905863-27905885 TGGTGAGGCAGGGGTGGGAGTGG - Intronic
1136165738 16:28451765-28451787 TGGCATCGCAGGGCTGGCCATGG - Intergenic
1136197234 16:28663244-28663266 TGGCATCGCAGGGCTGGCCATGG + Intergenic
1136213573 16:28777391-28777413 TGGCATCGCAGGGCTGGCCATGG + Intergenic
1136258306 16:29057315-29057337 TGGCATCGCAGGGCTGGCCATGG + Intergenic
1136320189 16:29479001-29479023 TGGCATCGCAGGGCTGGCCATGG - Intergenic
1136434760 16:30218342-30218364 TGGCATCGCAGGGCTGGCCATGG - Intergenic
1136512634 16:30748601-30748623 TGGCAGGGCAGGGAGGGGAGTGG - Intronic
1136514374 16:30759144-30759166 TGCCAGGGCAGGGCTGGGCTGGG - Exonic
1136648738 16:31646923-31646945 TGGAATGGAAGGACTGGGCGCGG + Intergenic
1136719780 16:32310653-32310675 GGGCCCGGCAGGGGTGGGCAAGG - Intergenic
1136721047 16:32319930-32319952 CAGCATGACAGGGGTGGGCAGGG + Intergenic
1136838155 16:33516933-33516955 GGGCCCGGCAGGGGTGGGCAAGG - Intergenic
1136839428 16:33526216-33526238 CAGCATGACAGGGGTGGGCAGGG + Intergenic
1136909653 16:34135269-34135291 TGGCGGGGCACGGGTGGGCGAGG + Intergenic
1137355862 16:47763209-47763231 TGGCATGGCGGGGCAGGGCAGGG - Intergenic
1137428369 16:48398849-48398871 TGGCAAGGCAGAGGAGGGCTGGG - Intronic
1137497811 16:48984217-48984239 AGGCATGGCAAGGGGTGGCGTGG + Intergenic
1137751386 16:50863495-50863517 TGCCGGGGCAGGGGTGGGAGAGG + Intergenic
1138023255 16:53503255-53503277 GGGCAGGGCAGGGCAGGGCGGGG - Intronic
1138482240 16:57311069-57311091 GGGCAGGGCAGGGGAGGGTGGGG + Intergenic
1138551259 16:57749950-57749972 GGGCATGGCTGGGGTGGCCCTGG - Intronic
1138605785 16:58088080-58088102 AGGCGGGGCAGGGGTGGGTGAGG - Intergenic
1139374024 16:66485684-66485706 TGGCATGGCTGAGGTGGGGACGG - Intronic
1139595844 16:67957865-67957887 TGGCGTGGGAGGGTTGGGCTGGG - Intronic
1139821131 16:69722157-69722179 TGGCAGGGTGGGGGTGGGGGCGG + Intronic
1139842428 16:69892345-69892367 GGGCCTGTCAGGGGTGGGTGGGG - Intronic
1139909967 16:70391673-70391695 GGGTATGGCAGGGGTAGGCAGGG + Intronic
1140242088 16:73211831-73211853 TGGAATGGCAGGGAGGGGGGTGG + Intergenic
1140394588 16:74615798-74615820 AGGCATAGCATGGCTGGGCGTGG + Intergenic
1140482991 16:75272520-75272542 TGGCAGGGCAGGGCGGGGTGGGG + Intergenic
1141223693 16:82094995-82095017 TGGCATGGGAGGGATGGGTAGGG + Intronic
1141635541 16:85312122-85312144 GGGGATGGAAGCGGTGGGCGAGG - Intergenic
1141829466 16:86501700-86501722 GGGTCTGGCAGGGGTGGGGGTGG - Intergenic
1141862515 16:86727664-86727686 TGGCCTGGCAGAGGTGGGGCTGG + Intergenic
1142052139 16:87965603-87965625 TGGCTGGGCGGGGCTGGGCGGGG + Intronic
1203005385 16_KI270728v1_random:197840-197862 CAGCATGACAGGGGTGGGCAGGG - Intergenic
1203006651 16_KI270728v1_random:207116-207138 GGGCCCGGCAGGGGTGGGCAAGG + Intergenic
1203136935 16_KI270728v1_random:1733961-1733983 CAGCATGACAGGGGTGGGCAGGG - Intergenic
1203148325 16_KI270728v1_random:1817213-1817235 GGGCCCGGCCGGGGTGGGCGAGG - Intergenic
1203149592 16_KI270728v1_random:1826501-1826523 CAGCATGACAGGGGTGGGCAGGG + Intergenic
1142679126 17:1535351-1535373 GGGCATGGCTGGGGTGAGCTGGG - Intronic
1142715068 17:1742803-1742825 TGGGAGGGGAGGGGTGGGCTGGG + Intergenic
1142891549 17:2947252-2947274 TGGCTTGGCGGGGGTGGTGGGGG + Intronic
1143485898 17:7253703-7253725 TGGCATTCCATGGCTGGGCGCGG + Intronic
1143747187 17:9003301-9003323 GGGGATGGCGGGGGTGGCCGCGG + Intergenic
1143871009 17:9957335-9957357 AGGGAAGGCAGGGATGGGCGAGG + Intronic
1145202339 17:20957635-20957657 AGACATGGAAGGGCTGGGCGTGG + Intergenic
1145262123 17:21360768-21360790 TGGCATTGCGGGGGTGGCAGGGG + Intergenic
1145752730 17:27367024-27367046 TGACATGGAAGGGGAGAGCGTGG - Intergenic
1145764816 17:27451374-27451396 TGGCGGGGCAGGGGTGGGTAGGG + Intergenic
1146173492 17:30650235-30650257 TGGCAGGGCTGGGCTGGGCTTGG + Intergenic
1146316782 17:31813555-31813577 TGGCATGGTGGTGGTGGGAGAGG + Intergenic
1146421950 17:32695148-32695170 CGGCATGGTGGGGGTGGGGGTGG + Intronic
1146518903 17:33511111-33511133 GGGCATGGATGGGGTGGGTGGGG - Intronic
1146688117 17:34855439-34855461 GGGCAGGGAAGGGGTAGGCGTGG - Intergenic
1146805949 17:35865132-35865154 GGGCAAGGAAGGGGTGGGCCAGG - Intronic
1147255038 17:39176335-39176357 TGACATGGCAGGGGAGGGACTGG - Intronic
1147465624 17:40608596-40608618 TGGGATGCCAGGGGTTGGGGTGG - Intergenic
1147567412 17:41546256-41546278 TGGCATGGCGGGGCTGGCGGGGG - Intergenic
1147736354 17:42641089-42641111 TGGCGGGGCAGGGGGGGGGGGGG + Intergenic
1147742807 17:42678337-42678359 GGGCAGGGCTGGGCTGGGCGGGG + Intergenic
1147855304 17:43475343-43475365 GGTGATGGCAGGGGTGGGGGTGG + Intergenic
1147907486 17:43832726-43832748 TGGCGTGGCGGGGCGGGGCGGGG - Intronic
1148152593 17:45405309-45405331 GGGCAGGGCTGGAGTGGGCGGGG - Intronic
1148158256 17:45435725-45435747 TTGCATGCCAGGAGTGGGCAGGG - Intergenic
1148255878 17:46131800-46131822 TGGCTTGGCAAGGGTGGTGGTGG - Intronic
1148598159 17:48873337-48873359 GGGAATGGGAGGGGTGGGTGTGG + Intergenic
1148605994 17:48929202-48929224 TGGAAGGGCAGGGCTGGGTGGGG + Intergenic
1148784209 17:50137575-50137597 TGTCCTGGCAGGGGTAGGCCAGG - Intronic
1148785903 17:50146094-50146116 TGCCAAGGCAGGGGTGGCCTCGG - Intronic
1149538041 17:57447575-57447597 TGGAGTGGCATGGGTGGGGGGGG + Intronic
1149979897 17:61302128-61302150 TGGCATGGCAAGAGTGGGACAGG - Intronic
1150063019 17:62085067-62085089 TGGAATCACAGGGGTGGGTGGGG + Intergenic
1150250635 17:63702405-63702427 CAGCATGGCAGGGATGGGCGGGG + Intergenic
1151423797 17:74016517-74016539 CGTCAAGGCAGGGGTGGGGGTGG - Intergenic
1151425568 17:74029064-74029086 TGGCATGGCCCTGGAGGGCGGGG - Intergenic
1151763409 17:76120294-76120316 TGGTATGGGAGGTGTGGGGGTGG - Intronic
1151796226 17:76347724-76347746 TGGCAGGGCAGGAGTGGCCACGG + Intronic
1151938980 17:77281247-77281269 GCGCAGCGCAGGGGTGGGCGGGG + Intronic
1152013979 17:77737500-77737522 TGGCATGGCATGGCATGGCGTGG - Intergenic
1152072760 17:78142125-78142147 CAGCATGGCAGGGGTGGGGGTGG - Exonic
1152336889 17:79703761-79703783 TGGCATGGCTGCTGTGGGCATGG - Intergenic
1152407345 17:80105135-80105157 GGGCAGGGCAGGGGCGGGGGCGG + Intergenic
1152460152 17:80438305-80438327 GGGCTGGGCAGGGGTGGGCCTGG + Intergenic
1152546758 17:81004167-81004189 GGGCTGGGCAGGGTTGGGCGGGG - Intronic
1152550608 17:81028155-81028177 TGCCCTGGCGGGGGTGGGCGGGG - Intergenic
1152593151 17:81223315-81223337 GGGCAAGGCAGGTGTGGGCGGGG + Intergenic
1152639183 17:81442591-81442613 TGCCGTGGCAGGGGAGGGCAAGG + Exonic
1152753926 17:82079070-82079092 TTGCATGGCGGGGGTGGGGTGGG + Exonic
1152863302 17:82708817-82708839 GGGCATGGCAGCAGTGGGTGGGG - Intergenic
1152874904 17:82781120-82781142 ACGCATGGCAGGTGTGGGGGAGG + Intronic
1152936349 17:83139723-83139745 TGGCTTGGCAGGGGTTGTTGGGG + Intergenic
1153732569 18:8029341-8029363 TGGCAGGACAGGTGTGGGGGAGG - Intronic
1155474421 18:26223964-26223986 CGGCAGGGCAGGGCTGGGTGGGG - Intergenic
1155907660 18:31471545-31471567 TGGCAGGGCAGAGGTGGCAGTGG + Intronic
1157452574 18:47799650-47799672 AGGCATGGCAGGGGTGGGGATGG - Intergenic
1157464271 18:47930721-47930743 TGGGCTGGCGGGGGAGGGCGCGG - Intronic
1157874724 18:51261564-51261586 TGGGATGGATGGGGTGGGAGGGG + Intergenic
1157988615 18:52468642-52468664 TAGCATGGCAGTGGTTGGCTGGG - Intronic
1158663586 18:59412055-59412077 TGACAGGGCATGGCTGGGCGTGG - Intergenic
1160132308 18:76237092-76237114 TGTGCTGGCAGGGGTGGGAGTGG - Intergenic
1160155621 18:76431956-76431978 CGCCAGGGCAGTGGTGGGCGGGG - Intronic
1160164284 18:76496126-76496148 AGGGATGGCCGGGGTGGGGGAGG + Intronic
1160356227 18:78230095-78230117 AGGAATGGCAGAGGTGGGCATGG - Intergenic
1160709410 19:544184-544206 CTGGATGGGAGGGGTGGGCGCGG + Intronic
1160797452 19:952679-952701 GGCCACGGCAGGGGTGGGAGGGG - Intronic
1160990951 19:1860106-1860128 TGGCATGCCGGGGGCGGGGGGGG + Intronic
1161024971 19:2032541-2032563 GGGCCTGGCAGGGCTGGGCGGGG + Intronic
1161323282 19:3651146-3651168 AGGCGTGGCAGGCGTGAGCGTGG - Intronic
1161332213 19:3693715-3693737 TGGCAGGACAGGGATGGGTGAGG - Intronic
1161337214 19:3721188-3721210 GGGCAGGGCAGGGCCGGGCGCGG - Intronic
1161403272 19:4078255-4078277 TGGCCTGGCCGGGGCGGGGGGGG + Intergenic
1161589743 19:5123981-5124003 TGGGCTGGCAGGGGTGGGCTGGG + Intronic
1161636896 19:5394825-5394847 TGGCGGGGCGGGGGTGGGGGTGG + Intergenic
1161979832 19:7624615-7624637 TGGCAGTGCAGGGCAGGGCGGGG - Intronic
1162235190 19:9303522-9303544 TGGCATGCCAGGAGAGGGCATGG - Intronic
1162566120 19:11446597-11446619 GGGCAGGACAGGGGTGGGGGAGG - Intronic
1162645643 19:12048226-12048248 TGGCAGGCCTGGGCTGGGCGCGG + Intronic
1162789895 19:13057359-13057381 TGGGATGGCAGGGGAGGAGGCGG + Intronic
1162903162 19:13807348-13807370 TGGCATGACTTGGGTGGGGGTGG + Intronic
1162930827 19:13956677-13956699 GGGCAGGGCTGTGGTGGGCGTGG - Intronic
1163236672 19:16034080-16034102 GGGCCTGGCAGAGGTGGGGGAGG + Intergenic
1163251575 19:16129021-16129043 TTGCCTGGCAGGGCTGGGAGCGG - Intronic
1163418692 19:17202321-17202343 TGGCATGTCACAGGTGGGCGTGG - Intronic
1163418696 19:17202341-17202363 TGGCGAGGCATGGGTAGGCGTGG - Intronic
1163418703 19:17202371-17202393 TGGTGAGGCATGGGTGGGCGTGG - Intronic
1163418710 19:17202402-17202424 GGGCAGGGCATGGGTGGGTGTGG - Intronic
1163418731 19:17202516-17202538 TGGCATGGCATGGGTGGGTGTGG - Intronic
1163435619 19:17293456-17293478 TGGGGGGGCGGGGGTGGGCGGGG + Intronic
1163585319 19:18160786-18160808 GGGCATGGGAGGGGTGGGGAGGG - Intronic
1163717214 19:18879532-18879554 GGGCATGGCAGGGGAGGGGAAGG - Intronic
1163737015 19:18987840-18987862 TGGCCAGGGAGGGGTGGGCAAGG + Intergenic
1163810540 19:19428856-19428878 TAGCATGCCAGGGGTGGGGCAGG + Intronic
1164520063 19:28972314-28972336 GGGCATGGCTGGGATGGGTGTGG - Intergenic
1164520703 19:28976949-28976971 GGGCATGGCAGAGAGGGGCGAGG + Intergenic
1164594782 19:29525895-29525917 TGGCAGGAGAGGGGAGGGCGGGG + Intergenic
1165121469 19:33561515-33561537 TGGAATGGCGGGGGTGGGGGGGG + Intergenic
1165138855 19:33687388-33687410 AGGCAAGGCAGGGGTGGCCTCGG + Intronic
1165145383 19:33726990-33727012 TGGCACGGAAGGGCTGGGCTTGG - Intronic
1165245050 19:34493916-34493938 TGGCCTGGCAGGGGATGGAGGGG - Intronic
1165310761 19:35028288-35028310 TTGCCTGGCAGGGCTGGGCCAGG + Intergenic
1165384807 19:35504046-35504068 GGGCAGGGCAGAGGTGGGCAGGG - Intronic
1165510817 19:36265811-36265833 TGGCAGGGTGGGGGTGGGAGTGG + Intergenic
1165862711 19:38917678-38917700 AGGGATGGCAGGGGTGGGGTAGG - Intronic
1165993095 19:39826989-39827011 TGGCAGGGAGGGGGTGGGAGGGG + Intronic
1166036010 19:40169131-40169153 TGGTAATTCAGGGGTGGGCGTGG - Intergenic
1166317593 19:41997779-41997801 TGGGCGGGCAGGGGTGGGAGAGG - Intergenic
1166343105 19:42150401-42150423 GGGAATGGCAGGGGAGGGGGTGG + Intronic
1167089234 19:47332029-47332051 TGGCAGGGCAGGAGAGGGCTCGG - Intergenic
1167252222 19:48405365-48405387 TGGAATGGGAGGGGTGTGGGAGG + Intronic
1167365618 19:49053649-49053671 TGGCAGTGCAGGTGTGGGGGGGG - Intergenic
1167425704 19:49428709-49428731 TGGCAGAGGAGGTGTGGGCGGGG - Exonic
1167456600 19:49599570-49599592 TGGCACAGCAGGGGTGGCAGGGG - Exonic
1167509952 19:49890733-49890755 TGGGATGTCAGGGACGGGCGGGG - Intronic
1167760268 19:51442385-51442407 AAGCATGGCAGTGGTGGGCATGG - Intergenic
1167964630 19:53132946-53132968 AGGAATGGCTGGAGTGGGCGGGG + Intronic
1168056391 19:53867394-53867416 CGGCAAGGAAGGGGTGGGGGCGG + Intronic
1168148366 19:54431712-54431734 TGGACAGGCAGGGGTGGGCAGGG + Intronic
1168263641 19:55209415-55209437 AGGCATGGCTGGGGCTGGCGGGG - Exonic
1168514566 19:57000795-57000817 GGGCAGGGCAGGTGTGGGCCGGG - Intergenic
925303855 2:2835627-2835649 TGGTCTGGCAGGGGTGGGTAGGG + Intergenic
925411758 2:3643615-3643637 AGGCAGGGCAGGCGTGGGCACGG - Intronic
925514974 2:4671593-4671615 AGCTATGGCAGGGGTGGGTGGGG + Intergenic
925966282 2:9069752-9069774 TTGCCTGGCAGGGGTGGAAGAGG - Intergenic
926340553 2:11901417-11901439 TGGCATGGAAGGGGTGCAGGGGG - Intergenic
927314302 2:21664296-21664318 TGGCATGGCAAGAGTGAGCAAGG + Intergenic
927516621 2:23675333-23675355 GGGCATTGCAGAGGTGGGGGTGG - Intronic
927682951 2:25152127-25152149 TGGCAGGGTGGGGGTGGGGGAGG - Intronic
928093416 2:28390408-28390430 TGGCAGGGCGAGGGCGGGCGAGG + Intergenic
928283227 2:29966675-29966697 TGGCAGGGCAGGGCAGGGCCAGG - Intergenic
928418849 2:31121846-31121868 GGGCAGGGCAGAGGTGGGAGTGG - Intronic
930374907 2:50552523-50552545 AGGAATGGCATGGGTGGGTGGGG + Intronic
930768582 2:55110016-55110038 TGGAATCTCAGGGCTGGGCGTGG + Intronic
931009038 2:57886467-57886489 TGGCTTGGCAGGGGAGGTGGGGG + Intergenic
931158820 2:59665536-59665558 TGGGGTGGCAGGGGTGGGAGGGG + Intergenic
931689079 2:64819956-64819978 TGTGGTGGCAGGGGTGGGAGAGG - Intergenic
931778703 2:65561867-65561889 TGACAGGGCAGGGGTGAGGGTGG + Intergenic
932442091 2:71743988-71744010 AGGGGTGGCAGGGGTGGGAGGGG - Intergenic
932442100 2:71744006-71744028 AGGGGTGGCAGGGGTGGGAGGGG - Intergenic
932961364 2:76415812-76415834 TGGCGGGGGAGGGGCGGGCGCGG + Intergenic
934072541 2:88397795-88397817 GGGCATGGCAGGGTTGGGTGAGG + Intergenic
934494384 2:94784531-94784553 TGGATGGGCAGGGGTGGGTGTGG - Intergenic
934572857 2:95383381-95383403 TGGACTGGCAGGGGTGGGACTGG - Intronic
934919874 2:98334196-98334218 TGCTGTGGCAGGGGTGGGGGTGG + Intronic
935315021 2:101824107-101824129 GGGCATGGCGGGGGTGGGGGCGG + Intronic
935403643 2:102685717-102685739 GTGCATGGCAGAGGTGGGGGTGG + Intronic
935593524 2:104862545-104862567 AGGGAGGGCAGGGCTGGGCGCGG + Intergenic
936148368 2:109996804-109996826 CAGCATGACAGGGGTGGGCAGGG + Intergenic
936196309 2:110374564-110374586 CAGCATGACAGGGGTGGGCAGGG - Intergenic
937064687 2:119009047-119009069 GGGCATGGAAGGGGTAGGTGTGG - Intergenic
937094476 2:119226505-119226527 TGGTTTGGCAGGGGTGGGGTAGG - Intronic
937900468 2:127015855-127015877 TGGCATGGCTGGGCTGGCCTGGG + Intergenic
937996888 2:127701219-127701241 TTGGAAGGCAGGGGTGGGTGTGG - Exonic
938240766 2:129740988-129741010 AGGCATGGCAGAGCTGGGCAGGG + Intergenic
938297063 2:130185017-130185039 TAGCCAGGCAGGGCTGGGCGCGG + Intronic
938427513 2:131203361-131203383 TGACATGGCAGTGGTGAGTGTGG - Intronic
938442838 2:131351936-131351958 GGGCATGGATGGGGTGGGAGGGG + Intronic
939186072 2:138862203-138862225 TAGCATGTCATGGGTGGGGGTGG + Intergenic
939365968 2:141231606-141231628 GGGCGGGGCAGGGGTGGGGGTGG - Intronic
940990773 2:160094123-160094145 TTACATGGCAGGGGAGGGGGAGG - Intergenic
941089642 2:161160245-161160267 TGGCTGGGCAGGGCTGGGGGAGG + Intronic
943620552 2:190143033-190143055 TGTCATGGCACTGGGGGGCGGGG + Intronic
943817618 2:192276734-192276756 TGGGAGGGCAGGGGTGGCCAGGG - Intergenic
944183669 2:196925628-196925650 TGGCATGGAAGCGGTAGGGGTGG + Intronic
944632796 2:201643539-201643561 TGGCAGGACAGAGGCGGGCGGGG - Intronic
944982619 2:205138865-205138887 TGCCATGGCAGGGGTCGAAGAGG - Intronic
945257276 2:207813193-207813215 GGGCAGGGCGGGGGTGGGGGTGG - Intergenic
946194527 2:218025093-218025115 TAGCATGGGAGGGGTGGGTAGGG - Intergenic
946239600 2:218345519-218345541 TGGCTTTGCAGGGATGGGTGGGG - Exonic
946959747 2:224971392-224971414 TGGAATGGGAGGAATGGGCGCGG + Intronic
947527217 2:230886125-230886147 TGACATGGCCAGGGTGGGCAGGG - Intergenic
947836968 2:233182796-233182818 TGGGATGGGAGGAGGGGGCGGGG + Intronic
947841596 2:233211276-233211298 AGGCAAGGCAGGGATGGGTGGGG - Intronic
947913818 2:233819272-233819294 TGGAGTGGCAGGGGAGGGCAGGG + Intronic
948178589 2:235962521-235962543 TGGGGAGGCAGGGGTGGGGGTGG + Intronic
948279549 2:236736354-236736376 TGGCAGGGCAGGGGGTGGCTGGG + Intergenic
948554274 2:238796497-238796519 GGGCAGGGCAGGGGTGGTCCAGG - Intergenic
948606380 2:239138603-239138625 CTGCAGGGCAGGGGTGGGAGGGG - Intronic
948801528 2:240435578-240435600 TGGGAGCGCAGGGGTGGGGGAGG - Intergenic
948894732 2:240922796-240922818 TGGCCTGGCAGGGCAGGGCAGGG + Intronic
948954201 2:241273886-241273908 TGGCAGGGGAGGGGAGGGCAGGG + Intronic
1168835676 20:875767-875789 TTGTATGGCAGGGTTGGGGGAGG + Intronic
1168864464 20:1073702-1073724 TGGCATGGCTGGGGTGGCCTCGG + Intergenic
1169938086 20:10906361-10906383 TGTGATGGCAGGGGTGTGGGTGG - Intergenic
1170226377 20:13995675-13995697 TGGAGTGGGAGGGGTGGGAGGGG - Exonic
1171467113 20:25337393-25337415 TGGCATGGGAGAGGAGGGCTGGG - Intronic
1171498401 20:25574313-25574335 TGCCATGGCATGGCTGGGCAAGG + Intronic
1171771380 20:29325490-29325512 TGGCAGGGCACGGGTGGGCGAGG - Intergenic
1171905130 20:30893991-30894013 CGGCGGGGCACGGGTGGGCGAGG + Intergenic
1172015499 20:31870467-31870489 TGGCTGGGCAGGGCTGGGCAGGG - Exonic
1172129086 20:32644016-32644038 TGGCTGGGCAGTCGTGGGCGTGG - Intergenic
1172443951 20:34983605-34983627 GGGCAAGGGAGGGGTGGGAGAGG + Intronic
1172701175 20:36854553-36854575 GGGCGGGGCAGGGGTGGGTGAGG + Intronic
1172841998 20:37907633-37907655 TGGCAGGGTGGGGGTGGGAGGGG - Intronic
1172848490 20:37944421-37944443 TGAAAGGGCAGGGGTGGGTGGGG - Exonic
1173085021 20:39907860-39907882 GGGCAAGGCAGTGGTGGGAGGGG - Intergenic
1173925678 20:46779575-46779597 AGCCATGGGAGTGGTGGGCGGGG - Intergenic
1174145621 20:48450402-48450424 TGGCATGGGATGGGTGGGAGGGG + Intergenic
1174287582 20:49483619-49483641 TGGAAGGGAAGGGGTGGGGGAGG + Intergenic
1175551764 20:59822219-59822241 TGGGATGGCAGGGGAGGGGGTGG - Intronic
1175954008 20:62598982-62599004 TGGCGTGGCTGGGCTGTGCGTGG + Intergenic
1175957917 20:62621073-62621095 AGGCACGGGAGGGGTGGGGGAGG - Intergenic
1175957958 20:62621160-62621182 AGGCACGGGAGGGGTGGGGGAGG - Intergenic
1176031667 20:63015916-63015938 TGACTGGGCAGGGGTGGGGGAGG - Intergenic
1178470192 21:32885701-32885723 TGGGATGGCAGGAGTGGGGAGGG - Intergenic
1179338978 21:40486518-40486540 GGGGATGGCAGGGGAGGGAGGGG + Intronic
1179342595 21:40526556-40526578 TGGCATGGTAGGTGAGGCCGGGG + Intronic
1179345891 21:40556967-40556989 TGGGGTGGCAGAGGTGGGAGAGG + Intronic
1179554257 21:42162546-42162568 TGGCTGGGCAGGGGTGAGTGAGG + Intergenic
1179554459 21:42163407-42163429 TGGCTGGGCAGGGGTGGGTGAGG + Intergenic
1179617378 21:42590669-42590691 TGGCAAGGCACGGCTGGGCCAGG - Intergenic
1179893985 21:44351264-44351286 CCGCATGGCAGGGGTGGCAGCGG - Intronic
1179987717 21:44930670-44930692 TGGCACTGCAGGGGTGGGGTGGG + Intronic
1180026455 21:45165073-45165095 TGGCTGGGCGGGGGTGGGCCTGG - Intronic
1180316764 22:11283337-11283359 TGGCGGGGCACGGGTGGGCAAGG - Intergenic
1180338557 22:11600171-11600193 TGGCGGGGCATGGGTGGGCGAGG + Intergenic
1180551724 22:16546380-16546402 CAGCATGACAGGGGTGGGCAGGG - Intergenic
1180938046 22:19638734-19638756 AGGCAGGGCAGGGCTGGGGGAGG + Intergenic
1180958289 22:19750861-19750883 GGGCAGGGCAGGGCAGGGCGTGG - Intergenic
1180958290 22:19750866-19750888 TGGCAGGGCAGGGCAGGGCAGGG - Intergenic
1181009449 22:20032012-20032034 TCACATGGCAGGGATGGGCAAGG - Intronic
1181052337 22:20243790-20243812 TGGCACTGCAGGGGTTGGCTGGG - Intronic
1181174824 22:21029457-21029479 AGGCAGGGCAGGGCTGGGCCGGG + Intronic
1181352282 22:22267543-22267565 CAGCATGACAGGGGTGGGCAGGG + Intergenic
1181459848 22:23079444-23079466 CAGCATGGCAGGAGTGGGGGAGG + Intronic
1181634247 22:24167063-24167085 TGGCTGGGCTGGGGTGAGCGGGG - Exonic
1181638963 22:24187024-24187046 AAGCATGGCAGGGGTGGCGGAGG + Intronic
1181639854 22:24190755-24190777 TGGCCTGGCAGGGGAGGCCTTGG - Intergenic
1182012526 22:27012409-27012431 AGGCATGGAAGGGGTTGGGGCGG + Intergenic
1182092043 22:27602542-27602564 GGGCGGGGCTGGGGTGGGCGGGG + Intergenic
1182835434 22:33337827-33337849 AGGTATGGCAGGGGTGGGGTGGG + Intronic
1183252198 22:36738063-36738085 TGGCAGGGCAGGGCAGGGCAGGG - Intergenic
1183252200 22:36738068-36738090 GGGCATGGCAGGGCAGGGCAGGG - Intergenic
1183331999 22:37227084-37227106 TGGCGTGGGAGGCGTGGGAGGGG - Intronic
1183332065 22:37227292-37227314 TGGCGTGGGAGGCGTGGGAGGGG - Intronic
1183348310 22:37319880-37319902 GGGCATGGTGGGGGTGGGCCGGG - Intergenic
1183379518 22:37484040-37484062 GGGCAGGGGAGGGGTGGCCGGGG + Intronic
1183432246 22:37772830-37772852 TGGCCTGGCTGGGGTGGTCCAGG - Intronic
1183482524 22:38072949-38072971 TGTCACGGCAGGGGTGTGCCAGG - Intronic
1183538273 22:38415614-38415636 TGGCAGAGCAGGGCAGGGCGCGG + Intergenic
1183648673 22:39141280-39141302 TGGCTTGGCAGGGGTTGTTGGGG - Intronic
1183658356 22:39204101-39204123 TGGCTTGGGAGGGCTGGGCGCGG - Intergenic
1183952600 22:41359886-41359908 TGGCATGGCAAGCATGGGGGCGG + Exonic
1184184693 22:42856951-42856973 TGGCCGGGCCGGGGCGGGCGGGG - Intronic
1184233604 22:43171450-43171472 TGCCAGGGCAGGCGGGGGCGGGG - Intronic
1184536902 22:45093791-45093813 TGGCATGGCAGGGCTCTGGGAGG - Intergenic
1184590151 22:45476564-45476586 TGGCATGGAATGGGTGGGACTGG + Intergenic
1184686210 22:46097528-46097550 TGCCAAGGCAGGGCTGAGCGAGG + Intronic
1184745522 22:46453533-46453555 TGGCCTGCCAGGGCTGGGTGTGG - Intronic
1184751489 22:46488947-46488969 GGGCAGGGCTGGGCTGGGCGTGG - Intronic
1184893208 22:47391906-47391928 GGGCTTGTCAGGGGTGGGTGGGG + Intergenic
1185067758 22:48640546-48640568 GGGCAGGGCAGGGCTGGGCTGGG + Intronic
1185134388 22:49060950-49060972 TGGGATGACAGGAGTGAGCGTGG + Intergenic
1185376199 22:50483611-50483633 GGGCAGGGCAGGGCTGGGTGGGG + Exonic
1185379811 22:50503200-50503222 GGGCATGGCTGGCGTGGGGGTGG + Exonic
949459364 3:4273796-4273818 GGGCATGGGAGGGGAGGGCATGG + Intronic
949459371 3:4273811-4273833 GGGCATGGGAGGGGAGGGCATGG + Intronic
949459376 3:4273826-4273848 GGGCATGGCAAGGGAGGGCATGG + Intronic
949490263 3:4582343-4582365 TGGGGTGGCGGGGGTGGGGGAGG - Intronic
949540329 3:5027102-5027124 AGGCTTGGGAGGGGTGGGGGCGG + Intergenic
949987270 3:9551330-9551352 GGGGATGGGAGGGGTGGGGGAGG - Intronic
950165959 3:10799142-10799164 GGGCAGGGCAGGGCAGGGCGAGG - Intergenic
950473178 3:13199083-13199105 TGGCACGGCGGGGGTGCGAGGGG + Intergenic
950536684 3:13582940-13582962 AGGCCTGGCAGGGTTGGGCAGGG + Intronic
950667336 3:14505552-14505574 TGTCTTGGCTGGGGTGGGCGAGG - Intronic
950726804 3:14922139-14922161 GAGCATGGCAGGGGTGTGGGGGG - Intronic
950740843 3:15050768-15050790 TGGCTTGTCGGGGGTGGGAGGGG - Exonic
951382258 3:21998071-21998093 TGGCATGGCACTGGTGGGAGTGG - Intronic
952326190 3:32322648-32322670 TGCCATGGCTGGGGTGGGAAGGG - Intronic
953251823 3:41251025-41251047 TCTCATGGCAGGGCTGGTCGGGG - Intronic
953730227 3:45440996-45441018 TGTGATGGCAGGGGTGAGTGAGG - Intronic
953769897 3:45771901-45771923 TGGCCTGGCAGGGGAGGTCTAGG + Intronic
953770757 3:45777306-45777328 AGGTATTGCAGGGGTGGGCGTGG - Intronic
953929546 3:46999129-46999151 TGGGATGCCAGGGGAGGGGGTGG - Intronic
954109786 3:48427610-48427632 TGGCATGGATCGGGTGGGAGAGG - Intronic
954154529 3:48678158-48678180 TGGCATGGATGGGGTGGGGATGG - Intronic
954292266 3:49655896-49655918 CGGCATGGCAGTGGTGGTGGTGG + Exonic
954328801 3:49878008-49878030 GGGGGTGGCAGGGGTGGGGGTGG + Intergenic
954332736 3:49899487-49899509 GGGCATGGCAGGGTGGGGCAGGG - Intronic
954676642 3:52319536-52319558 TGAGATGGCAGGGGTGGCCCTGG - Intronic
954851461 3:53604507-53604529 GTGCAGGGCAGGGGTGGGTGGGG - Intronic
955179542 3:56654379-56654401 AGCTGTGGCAGGGGTGGGCGGGG + Intronic
955696123 3:61638726-61638748 AGGCATGGCAAGGCTGGGCACGG - Intronic
956149197 3:66223362-66223384 TAGCATGGCAGGGGTTGGTATGG + Intronic
956792980 3:72694325-72694347 TGCCATGGCAGGGGGTGGCAGGG + Intergenic
958930114 3:100198939-100198961 AGGAATGGCAGTGGTGGGCCAGG - Intergenic
959661004 3:108868389-108868411 TAGCCAGGCAGGGCTGGGCGCGG + Intergenic
960685526 3:120289961-120289983 GCCCACGGCAGGGGTGGGCGGGG - Intergenic
961450643 3:127000896-127000918 TGGCATGGCCAGTGTGAGCGGGG - Intronic
961505468 3:127368299-127368321 TGGCAGGGCCGGGCTGGGCAAGG - Intergenic
961530566 3:127537543-127537565 GGACAGGGCAGGGGTGTGCGGGG - Intergenic
961820925 3:129575303-129575325 TGGCATGGCATGGCAGGGCTGGG + Intronic
962244799 3:133783855-133783877 GAGCCTGGCAGGGTTGGGCGGGG - Intergenic
962383223 3:134913255-134913277 GGGCATGGGAGGGGTGAGGGGGG + Intronic
963154786 3:142084832-142084854 TGGCGTGGCAGGGATGGCAGGGG + Intronic
965010580 3:163082890-163082912 GGGCATGTCAGGGGTTGGGGGGG + Intergenic
965475581 3:169150837-169150859 TGGCAGGGCTGGGGTGGGAGAGG + Intronic
965554406 3:170004711-170004733 GGGCCTGTCAGGGGTTGGCGGGG - Intergenic
966331485 3:178819513-178819535 GGGCATGGCTGGGATGGGGGTGG - Intronic
967278994 3:187804439-187804461 AAGCATGGGAGGGGTGGGTGGGG + Intergenic
967557210 3:190874543-190874565 GGGCAGGGCAGGGGTGGTTGAGG + Intronic
967814561 3:193788016-193788038 GGGCCTGGCAGGGGCTGGCGGGG + Intergenic
967892897 3:194375615-194375637 TGGCAGGTCAGGGATGGACGGGG - Intergenic
968052224 3:195662986-195663008 TGGGGTGGCAGGGGTGGGTGGGG - Intergenic
968103586 3:195985352-195985374 TGGGGTGGCAGGGGTGGGTGGGG + Intergenic
968186921 3:196639497-196639519 TGCCTTGGCAGGGCTGGGGGCGG - Intergenic
968301888 3:197622945-197622967 TGGGGTGGCAGGGGTGGGTGGGG + Intergenic
968606580 4:1538334-1538356 TGGGAGGGCAGTGGTGGGAGGGG + Intergenic
968735039 4:2290833-2290855 TGGCCAGGCAGGGCTGGGCCAGG - Intronic
969101510 4:4772376-4772398 TGGCATGGCATGGCGTGGCGTGG - Intergenic
969101511 4:4772381-4772403 TGGCATGGCATGGCATGGCGTGG - Intergenic
969158307 4:5232722-5232744 TTGCATGGCAGGGATGGTCTGGG + Intronic
969317773 4:6392430-6392452 TGGCATGGGAGGGGTGGGAGGGG + Intronic
969507961 4:7599733-7599755 TTGCAGGGCAGGTGTGGGCTGGG + Intronic
969518545 4:7662231-7662253 TGGCAGGGTGGGGGTGGGGGAGG - Intronic
969582481 4:8073203-8073225 AGGCGTGGTAGGGGTGGGGGTGG + Intronic
969872956 4:10116257-10116279 GGGCATGTCAGGGCAGGGCGGGG + Intronic
969875241 4:10131391-10131413 GGGCAGGGCACAGGTGGGCGCGG + Intergenic
970817857 4:20179110-20179132 TGGCTGGGCAGGGGTGGGGAGGG + Intergenic
971073805 4:23125525-23125547 TGGCAAGGGTGGGGTGGGGGGGG - Intergenic
971268408 4:25114674-25114696 TGGGATGGGAGAGGTGGGGGTGG - Intergenic
971521780 4:27561524-27561546 GGGCCTGTCAGGGGTGGGTGGGG + Intergenic
971694942 4:29888770-29888792 TGGCATGGCTGTGGTGAGCATGG + Intergenic
972324860 4:38005827-38005849 TGGCATGGCAGCAGTGGGACTGG - Intronic
972512237 4:39779043-39779065 TGGCAAGGCGGGGGTGGGGGGGG - Exonic
973290419 4:48465169-48465191 TGGCTGGGCATGGGTGGGGGTGG - Intergenic
974413227 4:61569065-61569087 TAGTGTGGCAGGGGTGGGAGTGG + Intronic
976226456 4:82798527-82798549 GGGCCTGGCATGGCTGGGCGAGG + Exonic
978848370 4:113302991-113303013 TGCCATGGCAGCGGGGGCCGGGG + Intronic
979608524 4:122665826-122665848 TATCATGACAGGGGTGGGCCAGG - Intergenic
980459273 4:133084899-133084921 TTGCAGGGAAGGGTTGGGCGGGG + Intergenic
980999646 4:139816514-139816536 CGCCATGGCAGCGGTGGGGGAGG + Intronic
981720625 4:147797899-147797921 TGGCATGGGATGGGTTGGGGTGG - Intronic
983429722 4:167633122-167633144 GGGCTTGTCAGGGGTGGGTGTGG + Intergenic
983534157 4:168839567-168839589 TGGGATGGGAGGGGTGAGGGAGG + Intronic
984734532 4:183098241-183098263 TGGCCCGGCCGGGGTGGGCCGGG - Intergenic
985150947 4:186946375-186946397 TGGCGGGGCAGGGGGGTGCGGGG + Intergenic
985654230 5:1121717-1121739 GGGCATGGCTGGGGCGGGCAGGG - Intergenic
985666056 5:1181984-1182006 TGGCCTGGGAGGGGTGGCCAAGG - Intergenic
985688628 5:1294984-1295006 CGGCATCGCGGGGGTGGCCGGGG + Exonic
985767164 5:1786183-1786205 AGGCTGGGCATGGGTGGGCGTGG - Intergenic
985805296 5:2038927-2038949 GGGCAGGGCAGGGCTGGGCTGGG + Intergenic
985805324 5:2039002-2039024 GGGCAGGGCAGGGCTGGGCAGGG + Intergenic
986244356 5:5991933-5991955 TGGCATGGCAGGGGGAGGGGGGG + Intergenic
986292628 5:6412166-6412188 TCAGATGGCAGGGGTGGGTGGGG + Intergenic
987097394 5:14561882-14561904 TGGCATGGTCGGGGTGGCAGGGG + Intergenic
987875419 5:23674942-23674964 TGGGCTGGTAGGGGTGGGCCCGG - Intergenic
987912770 5:24170180-24170202 GGGCAGGGCAGGGTGGGGCGGGG + Intronic
988213940 5:28247268-28247290 TGGGGTGGCGGGGGTGGGAGGGG - Intergenic
988223313 5:28378139-28378161 TGGCCTGTCGGGGGTTGGCGGGG - Intergenic
989627449 5:43444014-43444036 TGGCAGGGGCGGGGTGGGGGTGG - Intergenic
990299648 5:54437603-54437625 TGTCCTGGCAGGGTGGGGCGGGG - Intergenic
992834141 5:80623576-80623598 TGGCATGGTGGGGGAGGGGGAGG + Intergenic
993175845 5:84483891-84483913 TGGGGGGGCAGGGGTGGGGGTGG + Intergenic
996443045 5:123512717-123512739 TGTCGGGGGAGGGGTGGGCGAGG + Intronic
996540546 5:124626726-124626748 TGGCATGCCTGGGGAGGGCATGG - Intergenic
997371453 5:133363820-133363842 TGGAAAGACAGGGGTGGGCAGGG - Intronic
997593662 5:135091857-135091879 TGGGATGGCAGAGGTGGAGGGGG - Intronic
997864724 5:137450948-137450970 TTGCCTGGCATGGGTGGGCAGGG - Intronic
998138980 5:139689551-139689573 TGTCATTGCAGGGGAGGGGGCGG - Intergenic
998752702 5:145340419-145340441 GGTCATGGCAGTGGTGGGCTGGG - Intergenic
999181959 5:149676108-149676130 TGGCAGGGCAGGCGTGTGCAGGG + Intergenic
999493188 5:152071556-152071578 TGGTGTGGCAAGGGTGGGTGTGG + Intergenic
999989131 5:157033563-157033585 TGGCAGGGCGGGGGCGGGGGCGG + Intronic
1000323859 5:160157133-160157155 TGCCATGGCAGGGGTGTGTGTGG - Intergenic
1000348532 5:160334197-160334219 GGGCATGACAGCGGTGGGCGAGG - Intronic
1001570512 5:172727584-172727606 TGGCAGAGCAGGTGTGGGGGAGG - Intergenic
1001992891 5:176132853-176132875 GGGCATGGCATGGGTGGGAGTGG + Intergenic
1002132004 5:177087371-177087393 TGGCCCGGCAAGGGTGGGGGAGG + Intronic
1002443036 5:179274123-179274145 GGGTATGGCAGGGGAGGGCAGGG - Intronic
1002452431 5:179326486-179326508 GGGCATGGGAGTGGGGGGCGGGG - Intronic
1002921701 6:1577523-1577545 AGGCATGGCAGGGGCAGGCAGGG - Intergenic
1003233128 6:4272616-4272638 TGAGATGGCGGGGGTGGGGGGGG - Intergenic
1003754762 6:9104388-9104410 TGCCATGGATGGGGTGGGCTGGG + Intergenic
1003798875 6:9639056-9639078 TGGCATGGCAGTGAGGGGAGAGG + Intronic
1004456996 6:15800526-15800548 TGGAATGGCCAGGGTGGGAGTGG + Intergenic
1005375804 6:25181232-25181254 GGACAGGGAAGGGGTGGGCGAGG - Intergenic
1005495212 6:26382360-26382382 AGGCATGGCTGGAGTGGGAGGGG - Intergenic
1005504385 6:26457457-26457479 TGGCATGGCTGGAGCGGGAGGGG - Intergenic
1005995332 6:30927524-30927546 TAGCAGGGCAGGGCTGGGCATGG - Intergenic
1006030545 6:31173842-31173864 TGGCATGGCTGGGTGGGGAGAGG + Intronic
1006799422 6:36750543-36750565 TGGGATGGCAGGGTTGGGTGGGG - Intronic
1007175327 6:39892503-39892525 TGGCACAGCAGGGAGGGGCGTGG + Intronic
1007775724 6:44223472-44223494 CGGGGTGGCAGGGGTGGGCCGGG + Intronic
1007819104 6:44547478-44547500 TGCCATGGTGGGGGTGGGGGTGG - Intergenic
1007838449 6:44696338-44696360 TGGCATGGCAGGGGGAGGCCTGG + Intergenic
1009266093 6:61556290-61556312 TGGCAGTGCAGGGGTGGCGGCGG + Intergenic
1011507809 6:88067637-88067659 GGGGATGGCAGGGGTGGCGGGGG + Intergenic
1012297296 6:97541034-97541056 GGGGAGGGCAGGGGTGGGGGAGG - Intergenic
1013330363 6:109094771-109094793 TGGCTCGGCGGTGGTGGGCGAGG - Exonic
1013467404 6:110429887-110429909 TGGCATGGAAGGGGAGGAGGTGG + Intronic
1015838077 6:137444107-137444129 GGGAATGGCAGTGGTGGGCTGGG + Intergenic
1016012883 6:139157179-139157201 TGTCATGGCACTGGTGGGAGTGG + Intronic
1017025953 6:150180723-150180745 GAGCATGGCTGGGGTGGGGGCGG + Intronic
1017758634 6:157551129-157551151 TGGCTGGGTAGGGGTGGGCCTGG - Intronic
1017760257 6:157562930-157562952 TTGCAGGGCAGGGGTGGGGTTGG - Intronic
1017818334 6:158030965-158030987 TGGGATGGCAGGTCTGGGCTGGG + Intronic
1017985738 6:159441793-159441815 TGGCTGGGCAGGGCTCGGCGAGG + Intergenic
1018373227 6:163187308-163187330 TGGCGTGGGTAGGGTGGGCGAGG - Intronic
1018429612 6:163713071-163713093 TGGCATGGCTGGGGTTGGAAAGG + Intergenic
1019475917 7:1244166-1244188 TGGGATGGCAGCAGTGGGCCCGG - Intergenic
1019515208 7:1436883-1436905 GGGCATGGCAGTGGTGGGGGGGG - Intronic
1019598601 7:1869984-1870006 TGGCACGGCAGGGGCAGGGGAGG - Intronic
1020257048 7:6508235-6508257 TGGAAAGGCAGGGGTGGCGGTGG + Exonic
1021197393 7:17688518-17688540 TACCATTGCAGGGGTGGGAGTGG - Intergenic
1022262373 7:28718833-28718855 TGGCATTGTAGGGTTGGGCAGGG - Exonic
1022500919 7:30881991-30882013 TGGCAGGGCAGGGATGGCCCTGG + Intronic
1022989656 7:35695033-35695055 CGGCAAGGCAGGGCTGGGCCGGG + Exonic
1024058787 7:45683065-45683087 TGGGATGACAGGAGTGGCCGAGG + Intronic
1024233558 7:47380889-47380911 TGGCATGCCAGAGGAGGGCGGGG + Intronic
1024242078 7:47443358-47443380 TCAGATGTCAGGGGTGGGCGGGG - Intronic
1024524798 7:50338775-50338797 TGGCAAGGCAGGGCTGGGCCTGG + Intronic
1024532137 7:50402050-50402072 TGTCATAGCACGGATGGGCGGGG - Exonic
1025988275 7:66474637-66474659 GGGCCTGGCAGGAGTGGGCCGGG - Intergenic
1026282408 7:68933494-68933516 GGGCATGGCAGGGCAGGGCAGGG + Intergenic
1027355390 7:77349236-77349258 TGGCAGGGGAGGGGAGGGCAAGG - Intronic
1027803201 7:82781890-82781912 TGGCATGCCCAGGGTGGGCATGG + Intronic
1028659680 7:93255081-93255103 TGGACTGGCAGGGGTGGGGTAGG + Intronic
1028805349 7:95019822-95019844 TGGAATGGCTGGTTTGGGCGAGG - Intronic
1028909852 7:96195673-96195695 AGGTCTGGCAGGGGTGGGCATGG - Intronic
1029124141 7:98285643-98285665 TGGCACTGCTGGGGTGGGTGTGG + Intronic
1029139747 7:98401199-98401221 GGGCCCGGCCGGGGTGGGCGGGG + Intergenic
1029184226 7:98727155-98727177 TGACATGGCAGGAGTGGGCTGGG - Intergenic
1029470910 7:100753421-100753443 TGGCAGGGCTGGAGTGGGTGGGG + Intronic
1029550968 7:101236932-101236954 TGGGATTGCTGGGGTGGGCAGGG - Intronic
1029694370 7:102203337-102203359 TGGCTTGGCAGGGGAGGGGGTGG - Intronic
1029896740 7:103990729-103990751 TGGCAAGCCAAGGGTGGGTGGGG - Intergenic
1032011401 7:128350465-128350487 AGGCATGGCAGAGGTGGGTAGGG + Exonic
1032013163 7:128359902-128359924 TGGGATGGAGGGGGTGGGCTGGG + Exonic
1032204905 7:129854082-129854104 TGGCGGGGCAGGGGTTGGCGGGG + Intronic
1032528999 7:132604626-132604648 TGGCTGGGCAGGGGTGGGGTGGG - Intronic
1032576819 7:133063315-133063337 TGGCAGGGCAGAGGAGGGCTTGG - Intronic
1032797850 7:135291842-135291864 TTACATGGCAGGGGTGGGGAGGG - Intergenic
1033156081 7:138958229-138958251 AGGCAAGACTGGGGTGGGCGTGG - Intronic
1033457066 7:141512123-141512145 GGGAAGGGCAGGAGTGGGCGAGG - Intergenic
1035003904 7:155640985-155641007 TGGTATAGCAGGGCTGGGAGAGG - Intronic
1035133371 7:156676010-156676032 TGGCATGTCGGGGGAGGTCGAGG + Intronic
1035266172 7:157691325-157691347 TGTCCTGGGAGGGGTGGGTGGGG + Intronic
1035312321 7:157977367-157977389 TGGAGTGACAGGGGTGGGAGGGG + Intronic
1035456835 7:159014257-159014279 TGGCATGGGAGGGGGCGCCGGGG - Intergenic
1035569590 8:663208-663230 TGGCAGGACAGGGGCCGGCGGGG + Intronic
1035600680 8:895036-895058 TGGCAGGGCTGGGGTGGGTGTGG + Intergenic
1035874507 8:3173014-3173036 TGACAAGGCAGGGGTAGGGGTGG - Intronic
1036591452 8:10172441-10172463 TAGCAGGGCAGGGGAGGGGGAGG + Intronic
1036604709 8:10294859-10294881 CGGCTTGGGAGGGGTGGGGGCGG + Intronic
1036796996 8:11763529-11763551 GACCATGGCAGGGGTGGGAGTGG - Exonic
1037499113 8:19468668-19468690 TGTCATGGCAGGTGAGGGAGAGG + Intronic
1037799823 8:22026246-22026268 TTGCATGGATGGGGTGGGAGTGG - Intronic
1038288567 8:26227901-26227923 TTGCATGGGAGGGGTGTGTGTGG - Intergenic
1038740257 8:30211064-30211086 AAGAAAGGCAGGGGTGGGCGTGG - Intergenic
1039092143 8:33843678-33843700 TGGCATGGCTGGGATAGGCATGG + Intergenic
1039476296 8:37841029-37841051 GGGCATGGCTGGGGTGGGGCTGG - Intronic
1039561614 8:38516932-38516954 TTGGAGGGCAGGGGTGGGCAGGG - Intronic
1039846211 8:41327299-41327321 TGACATGGCAGCAGTGGGGGAGG - Intergenic
1039964599 8:42274788-42274810 TGGGATGGCGGGGGGGGGGGGGG - Intronic
1040725294 8:50375461-50375483 GGGCATGGCAGCTGTGGGAGGGG + Intronic
1042143781 8:65706094-65706116 GGGCATGGCAGAGGTGGGTGGGG + Intronic
1042361841 8:67892363-67892385 TGACATGGAATGGGTGGGAGTGG + Intergenic
1042821810 8:72937541-72937563 TGGCCTGGCTGTGCTGGGCGGGG - Exonic
1045115188 8:98973717-98973739 TGCCAGGGGAGGGGTGGGCACGG - Intergenic
1045509769 8:102805697-102805719 GGGCATGGCATGGGTGGGCGGGG + Intergenic
1046781321 8:118218520-118218542 GGGGATGGCAGGGGTGGGGGTGG - Intronic
1047097853 8:121642848-121642870 TGGCGTGGCGGGGGGGGGCGGGG - Intergenic
1047638177 8:126789725-126789747 TGGCAGGGCAGGGGCAGGGGAGG - Intergenic
1048255437 8:132901634-132901656 TGGGAAGGCAGGGGTGGGAGGGG + Intronic
1048282650 8:133116489-133116511 AGGCCTGGCAGGGGTGGGTTGGG + Intronic
1048348358 8:133595479-133595501 TGTCATGGTAGTGGTGGGGGCGG + Intergenic
1048805289 8:138235654-138235676 TGGCAGGGCAGGGTGGGGAGGGG - Intronic
1049224044 8:141441253-141441275 TGGCCCTGCAGGGGTGGGCCTGG + Intergenic
1049434530 8:142580215-142580237 TGGCCTGGCAGTGGTGGGAGTGG - Intergenic
1049576004 8:143389904-143389926 TGGCATTGCCGGGGTGGCAGAGG + Intergenic
1049655721 8:143796104-143796126 AGGCAGGGCAGAGGGGGGCGAGG + Intronic
1049664422 8:143836684-143836706 GGGGATGGGAGGGGTGGGGGGGG + Intronic
1049665041 8:143839287-143839309 TGGCGGGGCAGGGCTGGGTGGGG - Intronic
1049675254 8:143886304-143886326 TGCCCGGGCAGGGGTGGGCCTGG - Intergenic
1050289540 9:4139657-4139679 AAGCATGGAAGGGGTGGGCACGG + Intronic
1050921555 9:11208442-11208464 TTGCATGGCAGGAGAGGGGGAGG + Intergenic
1051579090 9:18651239-18651261 TGGCATGGTAAGGGAGGGAGGGG - Intronic
1051610331 9:18955793-18955815 TGGGGAGGCAGGGGTGGGAGTGG - Intronic
1052986608 9:34492461-34492483 TGCCATGTCCGGGGTGGGGGTGG + Intronic
1053415611 9:37945235-37945257 TTGCCTGGCAGGGGTGGGTGGGG - Intronic
1053450837 9:38192794-38192816 TGGCATGGTGGGGGTGAGAGGGG + Intergenic
1053475797 9:38381427-38381449 TGGCAGGGCAGGGCAGGGCGGGG - Intergenic
1053518610 9:38753988-38754010 TGTCGGGGCAGGGGTGGGTGGGG - Intergenic
1053662742 9:40295837-40295859 TGGATGGGCAGGGGTGGGTGTGG + Intronic
1054374872 9:64442061-64442083 TGGATGGGCAGGGGTGGGTGTGG + Intergenic
1054971583 9:71094076-71094098 GGGCCTGTCAGGGGTGGGGGTGG + Intronic
1055369213 9:75579013-75579035 TGGCAGGGTAGGGGTGGCCTAGG - Intergenic
1056571043 9:87815057-87815079 GGGATTGGCAGGGGTGGGTGGGG - Intergenic
1057053241 9:91941752-91941774 GGGCAGGGCGGGGCTGGGCGGGG - Intronic
1057219285 9:93247363-93247385 TGGCATGGCAGGGGTTTGCCAGG - Intronic
1057300634 9:93879824-93879846 AAGCATGGCCGGAGTGGGCGCGG - Intergenic
1057855272 9:98596574-98596596 TGGCAGGGCTGGGCTGGGCCAGG - Intronic
1057855274 9:98596579-98596601 TTCCATGGCAGGGCTGGGCTGGG - Intronic
1057881681 9:98796806-98796828 TGTCAGGGCAGAGGTGGGAGCGG + Intronic
1059436302 9:114278574-114278596 GGTCATGGCAGTGGTGGGGGTGG + Intronic
1059447511 9:114347893-114347915 TGGCCTGGCTGGGGTTGGAGTGG + Exonic
1059547876 9:115196956-115196978 TGGCATGGCAGGGTCTGGGGTGG + Intronic
1059631466 9:116128201-116128223 TGGCCTGGCAAGGCTGGGCCTGG - Intergenic
1059945607 9:119405562-119405584 TGGCATGGCAGGTGAGGGTTGGG + Intergenic
1060547184 9:124468430-124468452 TGGCAAGGCCGGGCTGGGCATGG + Intronic
1060603034 9:124890614-124890636 GGGCATGGCAGGGAGGGGCCAGG - Intronic
1061042754 9:128149464-128149486 GGGCCTGGCAGGGGTGGAAGAGG - Exonic
1061205962 9:129163656-129163678 AGGCATAGCAGGGGTGGAGGGGG - Intergenic
1061503183 9:131015332-131015354 GGGCAGGGCAGGGTTGGGCTGGG - Intronic
1061782762 9:133005410-133005432 TGGGATGGCTGCGGTGGGCTAGG + Intergenic
1061957752 9:133972378-133972400 GGGCAGGGCAGGGGTGGGGGAGG + Intronic
1062026205 9:134341896-134341918 TGGCTGGGCAGGGCTGGGCTTGG + Intronic
1062032085 9:134366308-134366330 TGGCAGGGCAGGCATGGGGGGGG - Intronic
1062093126 9:134688971-134688993 GGTCATGGCGGGGGTGGGGGTGG + Intronic
1062151082 9:135019403-135019425 TGGGCTGGCAAGGGTGGCCGTGG - Intergenic
1062269692 9:135702763-135702785 TGGCATGGCAGTGCTCGGCCAGG + Intronic
1062288972 9:135786167-135786189 GGGCAGGGCAGGGCAGGGCGGGG - Intronic
1062309593 9:135928808-135928830 TGGCCTCTCTGGGGTGGGCGGGG - Intergenic
1062461163 9:136663107-136663129 AGGTATGGCAGGGGTGGCCTCGG + Intronic
1185587157 X:1248686-1248708 TGGAATTCCAGGGGTGGGGGAGG - Intergenic
1186847599 X:13545945-13545967 AGGCATGGGAGGGGTGGCCTTGG - Intergenic
1187133444 X:16525064-16525086 TCGCATGGCTGGTGTGGGGGTGG + Intergenic
1188040905 X:25369232-25369254 GGGAATGGCAGAGGTGGGCTAGG + Intergenic
1190503270 X:51099941-51099963 TGACATGGCAGAGGTGGACATGG - Intergenic
1191141773 X:57121851-57121873 TGCAGGGGCAGGGGTGGGCGCGG - Intergenic
1191233393 X:58115233-58115255 TAGCATGTCTGGGGTGGGCCAGG - Intergenic
1191861149 X:65667540-65667562 TGGCCAGGCGGGGCTGGGCGGGG + Intronic
1192216839 X:69165070-69165092 TGGGAGGGCAGTGGTGGTCGCGG - Intronic
1193637353 X:83968965-83968987 TGGCAGGGTGGGGGTGGGTGGGG - Intergenic
1194254879 X:91623682-91623704 TAGGATGGCAGTGGTGGGCCAGG + Intergenic
1194450688 X:94041634-94041656 AGGCATGGCAGGGGCTGGAGTGG - Intergenic
1195751472 X:108164731-108164753 CGGCATGGTAGGGGTGGTAGGGG + Intronic
1195923631 X:110004431-110004453 GGGCACGGCAGGGTTGGGCTGGG - Intronic
1197828168 X:130612941-130612963 TGGCTGGGCAGGGGTAGGGGAGG - Intergenic
1199815258 X:151391929-151391951 GGGCGGGGCAGGGGAGGGCGGGG - Intergenic
1200064007 X:153496215-153496237 TGGCAGGCCAGGGAGGGGCGAGG - Intronic
1200573664 Y:4863285-4863307 TAGGATGGCAGTGGTGGGCCAGG + Intergenic
1201115590 Y:10832987-10833009 TGGAATGGCATGGATTGGCGTGG - Intergenic
1201987428 Y:19985295-19985317 GGGCAGGGCAGGGGTGGCGGGGG + Intergenic