ID: 1075744561

View in Genome Browser
Species Human (GRCh38)
Location 10:124717705-124717727
Sequence GTATGCATAAGGATTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075744561_1075744567 28 Left 1075744561 10:124717705-124717727 CCAAGCTCAATCCTTATGCATAC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1075744567 10:124717756-124717778 CTAACAACAACCTGATTTAGAGG No data
1075744561_1075744566 -10 Left 1075744561 10:124717705-124717727 CCAAGCTCAATCCTTATGCATAC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1075744566 10:124717718-124717740 TTATGCATACAGGGGCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075744561 Original CRISPR GTATGCATAAGGATTGAGCT TGG (reversed) Intronic
903909578 1:26712815-26712837 TAATGAATAAGGATTGTGCTTGG + Intronic
905987774 1:42302552-42302574 GTATGCCTAGGCATGGAGCTGGG + Intronic
907604003 1:55797845-55797867 GCATGCAGAAGAATTGAGTTTGG + Intergenic
908685769 1:66717691-66717713 GTATGCATAAAGTTTAAGATTGG - Intronic
909112613 1:71498751-71498773 GTATGCACATTGATTGGGCTTGG - Intronic
909625742 1:77713845-77713867 GTAAGAATAATGATTGAGCTGGG - Intronic
910143103 1:84048815-84048837 CTATGCATTAGGATTGGGGTGGG + Intergenic
910652946 1:89589475-89589497 GCATGGGAAAGGATTGAGCTAGG + Intronic
918891161 1:190270857-190270879 GAATGCATGAGGGTTGATCTTGG - Intronic
919706504 1:200681186-200681208 GTATGAGTTAGGATTCAGCTTGG + Intergenic
1069396979 10:68000252-68000274 GTATTCCTATGGATTGAACTGGG + Intronic
1071871194 10:89796492-89796514 GTATGGAAAAGGATGGAGGTTGG - Intergenic
1075744561 10:124717705-124717727 GTATGCATAAGGATTGAGCTTGG - Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1078652698 11:13210427-13210449 CCATGGATAAGGAGTGAGCTGGG + Intergenic
1079256300 11:18834304-18834326 GTATGCCTAAGTGTGGAGCTGGG + Intergenic
1079970539 11:27030921-27030943 ATTTGCAAAAGGATTCAGCTGGG - Intergenic
1089280026 11:117367441-117367463 TTAAGCATAAGAATTGAGCTGGG + Intronic
1089610426 11:119665580-119665602 CCATGAATAGGGATTGAGCTGGG - Intronic
1091098006 11:132841949-132841971 GCATGCAGATGGATTGACCTGGG - Intronic
1093138980 12:15485497-15485519 GCAAGCATAAGGCTTGGGCTAGG - Intronic
1107743389 13:43479090-43479112 GCATGCATAAAGATGGAACTGGG + Intronic
1108864993 13:54912186-54912208 GTATGCCTAGGCATGGAGCTTGG - Intergenic
1110594206 13:77300930-77300952 GCATGAGTAAGGACTGAGCTTGG + Intronic
1111721189 13:91947205-91947227 GTATGAATAAGGATTGAAAATGG - Intronic
1114907730 14:27151566-27151588 GTATGCCTAGGCATAGAGCTGGG + Intergenic
1116479145 14:45377087-45377109 ATATGCAGAAGAACTGAGCTAGG + Intergenic
1117624058 14:57617668-57617690 GTATGGATAAGCAGTGTGCTAGG + Intronic
1117731310 14:58724691-58724713 GAATGTATAATGATTGAGCCAGG + Intergenic
1124694262 15:31850642-31850664 GTATGCATCAGGGTTGTGGTGGG - Intronic
1125977190 15:43965051-43965073 GTATGGAAAAGGATAGAGCATGG + Intronic
1127137196 15:55936678-55936700 CTGTGCATAAGAATTGTGCTTGG - Intronic
1132110736 15:99100297-99100319 GTGAGCAGAAGGAATGAGCTGGG + Intronic
1132780187 16:1620008-1620030 GTGTGCATGACGATGGAGCTGGG + Intronic
1139190520 16:64857794-64857816 GTATGCAACAGAATTGATCTAGG + Intergenic
1143318953 17:6055262-6055284 GAGTGCAGAAGGATTGAGTTCGG + Intronic
1146867550 17:36350860-36350882 GTATGCATATGGCTTTATCTTGG - Intronic
1149399701 17:56283123-56283145 GTATGCTTAAGGATGGAGAGTGG - Intronic
1153633153 18:7090881-7090903 GTAAGCAGAAGGATTTAGCAGGG + Intronic
1164005444 19:21144247-21144269 GGCTGCAGAAGGATTGATCTTGG + Intronic
1165706004 19:37976632-37976654 TTATGAATAAGGAGTGAGGTTGG - Intronic
928409310 2:31042319-31042341 GTATGAATATGGAATGAACTGGG + Intronic
939828127 2:147040001-147040023 TTATGCATAAGGATCCAGTTTGG - Intergenic
942326812 2:174782760-174782782 GTAGGAATAAGGAATGAGGTTGG + Intergenic
942573358 2:177336585-177336607 GTGAGCATTAGGATTGAGTTGGG + Intronic
947960713 2:234234587-234234609 ATGTGCACAAGGATTTAGCTGGG + Intergenic
1169277097 20:4240983-4241005 CTATGAATAAGCAATGAGCTAGG - Intronic
1171410185 20:24941479-24941501 GTATGCAACACTATTGAGCTGGG + Intergenic
1177348599 21:19904357-19904379 ATATGCATAAGGATTTATTTTGG + Intergenic
1182420992 22:30248506-30248528 GTAAGAAGAAGGGTTGAGCTGGG - Intergenic
952240860 3:31530491-31530513 GGATGCATGGGGATTCAGCTAGG - Intergenic
962628045 3:137246736-137246758 GAATGCATAAGGAATGTCCTGGG + Intergenic
966173721 3:177112492-177112514 TTATGCATACAGATTGAGATCGG + Intronic
968724626 4:2240015-2240037 GTAAGCATAAGAAATGAGATTGG - Intronic
969521784 4:7682265-7682287 GTTTGTATGGGGATTGAGCTGGG + Intronic
971717367 4:30196277-30196299 TTATGCATAAGTACTGAGTTGGG - Intergenic
974709075 4:65564556-65564578 GTATAAATAGGGACTGAGCTCGG - Intronic
976332415 4:83847546-83847568 CCATGCATAAGGATAGGGCTTGG + Intergenic
981888881 4:149713295-149713317 GTGTTCATAAGGATTGACCTTGG - Intergenic
982891054 4:160850808-160850830 GTATGGAAAATGAATGAGCTGGG + Intergenic
983961072 4:173755470-173755492 GTATGCATATGGACAGAGATTGG + Intergenic
990154362 5:52857912-52857934 GTATGCATAAGTATAGAGATGGG - Intronic
991168610 5:63593852-63593874 GTATGCAAAAGGAGAGAGATAGG - Intergenic
1001258107 5:170200709-170200731 GGATGCATTAGGACTGAGTTGGG - Intergenic
1001439775 5:171733621-171733643 TTATCCATAAGGAGAGAGCTGGG - Intergenic
1003812363 6:9798948-9798970 GTATGCATACTGGTTGAGATTGG - Intronic
1004485682 6:16064191-16064213 ATATGAATAAGGATTTAGATGGG + Intergenic
1008859112 6:56127971-56127993 GTATGGATGGGGATGGAGCTTGG - Intronic
1009279503 6:61729174-61729196 GTAGGCACATGGATGGAGCTGGG + Intronic
1010335680 6:74680382-74680404 GTATGCAGAAGAATTAAACTGGG + Intergenic
1020446617 7:8275586-8275608 GAATGCATAATGTTTGAGCTGGG - Intergenic
1021673903 7:23061288-23061310 GTATGCATCATGAATGAGATAGG - Intergenic
1028304227 7:89242182-89242204 GTATGCATAAACATTGTTCTAGG - Intronic
1030799164 7:113827942-113827964 GTATGAATAATGACTGAGTTGGG + Intergenic
1034336911 7:150329821-150329843 GTTTGCATTTGGATAGAGCTTGG + Exonic
1034564108 7:151899734-151899756 GCATGCAGAAGGAATGAGGTGGG - Intergenic
1035332406 7:158104942-158104964 GTTTGGATAAGGGTGGAGCTGGG - Intronic
1037185280 8:16055356-16055378 CTATGCATCAGCATTGTGCTGGG - Intergenic
1039082018 8:33742877-33742899 GTATGCATCAGGGTGGGGCTTGG - Intergenic
1041870211 8:62625683-62625705 ATTTGCATAAGGATTGAGAAGGG + Intronic
1050687823 9:8191193-8191215 GTATGCCTAGGCATGGAGCTGGG - Intergenic
1052493349 9:29194115-29194137 GGCTGCATAAGGATTGAACAAGG + Intergenic
1056350528 9:85744223-85744245 GTCTGATTAAGGATTGAGGTGGG - Intergenic
1056458947 9:86790934-86790956 CTATGCACAAGATTTGAGCTAGG + Intergenic
1186938872 X:14482291-14482313 GTATGCATAATGAATTAGGTGGG + Intergenic
1187269316 X:17765414-17765436 GAAGGCATAAGGACTGGGCTGGG - Intergenic
1187859925 X:23671816-23671838 GTAGACATAAGTATTGAGGTCGG - Intronic
1193301948 X:79899659-79899681 GTATGCATAAGGGTTGGTATGGG - Intergenic
1194227164 X:91275110-91275132 ATATGCATAAGAATGGATCTAGG + Intergenic
1197552474 X:127910084-127910106 GTATGAACATGGATGGAGCTGGG + Intergenic
1198090996 X:133329740-133329762 CTTGGTATAAGGATTGAGCTAGG + Intronic
1200840416 Y:7775932-7775954 GTAGGCATAAACATTGAACTTGG + Intergenic
1201731754 Y:17212110-17212132 GTAGGCATGAAGATTGACCTTGG - Intergenic
1202364897 Y:24152721-24152743 GTATACATAAGTATTTGGCTGGG - Intergenic
1202505884 Y:25517401-25517423 GTATACATAAGTATTTGGCTGGG + Intergenic