ID: 1075746854

View in Genome Browser
Species Human (GRCh38)
Location 10:124733995-124734017
Sequence GAGTTTAGACAGATGAAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 318}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075746854_1075746857 21 Left 1075746854 10:124733995-124734017 CCGTTCTTCATCTGTCTAAACTC 0: 1
1: 0
2: 0
3: 28
4: 318
Right 1075746857 10:124734039-124734061 GGTCAGCTGTCACCCCCTCCAGG No data
1075746854_1075746856 0 Left 1075746854 10:124733995-124734017 CCGTTCTTCATCTGTCTAAACTC 0: 1
1: 0
2: 0
3: 28
4: 318
Right 1075746856 10:124734018-124734040 CTGCTCATTCTTCAAGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075746854 Original CRISPR GAGTTTAGACAGATGAAGAA CGG (reversed) Intronic
900509590 1:3052231-3052253 GAGGTTGGAAGGATGAAGAATGG - Intergenic
901065538 1:6492460-6492482 GAGTTTGGGGAGATGGAGAAAGG - Intronic
901245851 1:7730454-7730476 GAGTTTAGACAAGTCAGGAAAGG - Intronic
904324359 1:29718324-29718346 GACTTTACACAGATGTGGAATGG + Intergenic
904518580 1:31076383-31076405 GAGTTTTGACAAATGTATAATGG - Intergenic
905635539 1:39548932-39548954 CAGTTTGGTCAGATGAAGACTGG - Intergenic
907623194 1:56002904-56002926 TTGTTTAGAGAGATGAATAAGGG - Intergenic
909247329 1:73302946-73302968 AAGTTTAGAAACATGTAGAAGGG - Intergenic
909523355 1:76594835-76594857 GGCTGTAGACAGATGAGGAATGG - Intronic
909732495 1:78912258-78912280 GAGTCTAGTCAGTTGATGAAGGG - Intronic
910340303 1:86179605-86179627 TAGTTTGGAAAGATGAAAAAAGG - Intergenic
910508499 1:87977411-87977433 GAGTTAAGGCAGGTGAAGGAAGG - Intergenic
910599430 1:89015024-89015046 GAGTTAACACAGATGCATAAAGG - Intronic
910653343 1:89593429-89593451 AAGTTAATAAAGATGAAGAATGG + Exonic
910902107 1:92132280-92132302 GAGTTTAGCTATATGAATAAAGG + Intronic
910984346 1:92991112-92991134 GAGTTTAGAGAGTTCAAGAGAGG + Intergenic
911183782 1:94883910-94883932 GAATATACACAGAGGAAGAAAGG - Intronic
912756291 1:112327199-112327221 GGGTTTTGACAAATGTAGAATGG + Intergenic
913566077 1:120073857-120073879 GAGTTTACAAACATGAATAAGGG - Intergenic
913632054 1:120719696-120719718 GAGTTTACAAACATGAATAAGGG + Intergenic
914286665 1:146233216-146233238 GAGTTTACAAACATGAATAAGGG - Intergenic
914547696 1:148683957-148683979 GAGTTTACAAACATGAATAAGGG - Intergenic
914618816 1:149386397-149386419 GAGTTTACAAACATGAATAAGGG + Intergenic
915837084 1:159186076-159186098 AAGTTTAGACATGTGAAGATGGG + Intronic
917954791 1:180084176-180084198 GAGGTTAGACATAGGAAGAAGGG + Exonic
918262870 1:182812101-182812123 GAGTTTAGAGGCATGCAGAAGGG - Intronic
918658041 1:187053573-187053595 GAGATAATTCAGATGAAGAAGGG + Intergenic
919074248 1:192794700-192794722 GAAGTTAGTCAGATGAAGAATGG + Intergenic
919141499 1:193578202-193578224 GAAAGTAGACAGATGAAAAAGGG - Intergenic
919692107 1:200537046-200537068 GCGTTTAGGCAGAGGAACAAGGG - Intergenic
919697369 1:200591636-200591658 GAATTTAGCCAGAGGAAGACTGG - Intronic
920718352 1:208363090-208363112 GAATTTAGACAAATGGAAAAAGG - Intergenic
921364624 1:214362056-214362078 GAGTTTGGACAGGAGAAAAATGG + Intronic
921771871 1:219050357-219050379 GAGTTCAGAGAAAGGAAGAAAGG + Intergenic
922055208 1:222036105-222036127 GGGTTTAGACAAATGTATAATGG - Intergenic
922245089 1:223788112-223788134 CAGCTGAGAGAGATGAAGAAGGG + Intronic
923456018 1:234166380-234166402 GAGTTTGGACAAATGTATAATGG + Intronic
924116573 1:240753500-240753522 GAGTTTAGAAATATGGAGAGGGG - Intergenic
924654928 1:245965814-245965836 GAGTTTGCACAAATGTAGAATGG - Intronic
924862649 1:247941380-247941402 GAGTTTAGATATATAAAGAATGG + Intronic
924866942 1:247993498-247993520 GAGTTCAGATATATAAAGAATGG + Intronic
1063266771 10:4459724-4459746 GGAGTTAGCCAGATGAAGAAGGG - Intergenic
1064538379 10:16381447-16381469 GAATGTAGACAAATGATGAACGG + Intergenic
1066307804 10:34163384-34163406 GAATTTGAAAAGATGAAGAAAGG + Intronic
1067017194 10:42766818-42766840 GAGTTTTGACAAATGCATAAAGG - Intergenic
1069130393 10:64694177-64694199 GGAGTTAGATAGATGAAGAAGGG + Intergenic
1071839439 10:89454027-89454049 GAGCTGAGACAAATGAAGGAAGG - Intronic
1073611838 10:104951819-104951841 AAGATTAGCCAGATGGAGAATGG - Intronic
1074278894 10:112032291-112032313 GAGTAGAGAGAGATAAAGAAGGG + Intergenic
1074403427 10:113161104-113161126 GAGTCGAGACACATGGAGAAGGG + Intronic
1074407367 10:113190955-113190977 GAGATTAGAGAGAGGAAGCATGG + Intergenic
1074994981 10:118749010-118749032 GAGTCCAGACATATGAAGAAAGG + Intronic
1075746854 10:124733995-124734017 GAGTTTAGACAGATGAAGAACGG - Intronic
1076302846 10:129440961-129440983 GGGTTTACACAGATGCAAAATGG - Intergenic
1079409213 11:20171402-20171424 ATGTTTAGCCATATGAAGAAAGG + Intergenic
1079504744 11:21141049-21141071 TAGTTTTTACAGATGAAAAATGG + Intronic
1079596086 11:22249197-22249219 GAGTGTTGAAATATGAAGAATGG + Intronic
1080102737 11:28478135-28478157 AACTTTAGTCAGATAAAGAAAGG + Intergenic
1080962746 11:37179479-37179501 GAATTTAGAAACCTGAAGAAGGG - Intergenic
1081750638 11:45508363-45508385 GAGTTTACACAGCTGGTGAATGG - Intergenic
1082724863 11:56722261-56722283 GAGTTTAGAAGGATGGAGAATGG + Intergenic
1083608694 11:63994628-63994650 GAGCTTAGAGAGATGAGGAGTGG + Intronic
1083817691 11:65145927-65145949 GAGCTTCGTCATATGAAGAAAGG + Intergenic
1084163086 11:67361358-67361380 GAATTCAGACAGATGGAGATGGG - Intronic
1084529500 11:69718579-69718601 GAGTTTAGACACAGAAAGCAGGG - Intergenic
1085219120 11:74858669-74858691 GAGTTTAATCAGGTGAAGAGGGG - Intronic
1086120408 11:83299667-83299689 GATTTTAGAAAGATATAGAAGGG + Intergenic
1087078766 11:94150361-94150383 CAGTTTAAACAGGTGGAGAAGGG + Intronic
1089026711 11:115278465-115278487 GAGTTAAGAGAGAGGAAGAAGGG + Intronic
1089645693 11:119877107-119877129 GAGTTAGGCCAGATGAGGAAGGG - Intergenic
1090907363 11:131088615-131088637 GAGGTTAGAAAAATGAAGATAGG - Intergenic
1092657669 12:10704120-10704142 GAGATTGGAGAGATGAAGGATGG - Exonic
1096300210 12:50420569-50420591 GAGTAAAGAGAGATTAAGAATGG + Intronic
1097259323 12:57707025-57707047 AAATTTAGACAAATGAATAATGG - Intronic
1097275005 12:57807201-57807223 TGGATTAGACAGAGGAAGAAGGG - Intronic
1097614733 12:61870579-61870601 GAGATTAGAGACATAAAGAAAGG - Intronic
1097745055 12:63292380-63292402 GAGTTTACAAAGATGATGAAGGG + Intergenic
1097917551 12:65036742-65036764 CAGTTTTAAAAGATGAAGAAGGG - Intergenic
1097922434 12:65090622-65090644 GAGGTTAAACAGGTGAAGGAGGG + Intronic
1099029378 12:77506261-77506283 GAGTTTAAACAAGTGAACAATGG - Intergenic
1099380911 12:81951226-81951248 GAGTTAAGCCACATGAAGAAGGG + Intergenic
1099876219 12:88409301-88409323 GAGTATAGAAAGAAGGAGAATGG + Intergenic
1101074203 12:101111444-101111466 GTATTTGGAAAGATGAAGAAAGG + Intronic
1102395222 12:112579917-112579939 GAGATTAGAAATATGAAGATGGG - Intronic
1104361277 12:128135521-128135543 GATTTTTCACAGATGAAGCAGGG - Intergenic
1105626769 13:22120388-22120410 TAATTTAGACAGATCAAAAACGG - Intergenic
1106128987 13:26923885-26923907 GAAGTTAAACAGATGCAGAAAGG - Intergenic
1106863054 13:33932163-33932185 TAGAATAGACAGATGAACAATGG - Intronic
1107458683 13:40579455-40579477 GAGTTATGACAGGAGAAGAATGG + Intronic
1107486001 13:40828141-40828163 CAGTTTAGATAAAGGAAGAAGGG + Intergenic
1109092794 13:58070050-58070072 GAGTTTAGGCAGAAGAACCACGG - Intergenic
1109102050 13:58198029-58198051 GGATTAAGAGAGATGAAGAAAGG + Intergenic
1109433577 13:62269028-62269050 GAGTTCACACAGTGGAAGAAAGG - Intergenic
1109440814 13:62370544-62370566 GAGTTATCACAGATAAAGAAAGG + Intergenic
1109448986 13:62483784-62483806 GAGTGGAGAAAGAGGAAGAAGGG - Intergenic
1109880677 13:68470872-68470894 GAGTAAAGTCAAATGAAGAATGG + Intergenic
1112652391 13:101414192-101414214 GAGCTTAAACATATTAAGAATGG - Intronic
1112807995 13:103184019-103184041 GTGTTTAGTCAAAGGAAGAAGGG + Intergenic
1114755957 14:25260416-25260438 GTGTTTAGCCAGATGAAAACTGG - Intergenic
1115213485 14:30991653-30991675 GAGTTTAGGGAAATAAAGAATGG + Intronic
1115607786 14:35022208-35022230 GAGGGTAGACATATGAAGTATGG + Intronic
1116030513 14:39565534-39565556 GAGCTTTGACAGATGAAGGCTGG + Intergenic
1116288239 14:43000603-43000625 GACTTTAGACAAATTAACAATGG - Intergenic
1116798927 14:49422481-49422503 GAGTTAAGCCTGATGAATAAAGG - Intergenic
1117780490 14:59226737-59226759 AAGTTTAGAAAGATGGAAAAGGG + Intronic
1117928471 14:60811694-60811716 GAGTTTAGAAAGATGACTAGAGG - Intronic
1118656264 14:67953237-67953259 GAATTTGGACAGATTAAGATGGG + Intronic
1118656488 14:67955856-67955878 GAATTTGGACAGATGAAGATGGG + Intronic
1120515084 14:85461108-85461130 GCTTTTAGACATCTGAAGAAAGG - Intergenic
1120908705 14:89645238-89645260 GAGATGAGGCAGGTGAAGAACGG - Intergenic
1121972790 14:98374111-98374133 TGCTTTATACAGATGAAGAAGGG - Intergenic
1123879208 15:24659216-24659238 AAGTTATCACAGATGAAGAAGGG - Intergenic
1123911803 15:24975493-24975515 GAGTTCAGAAAGATCAAGTAAGG + Exonic
1124622587 15:31283335-31283357 GGGTTTAGACAAATGTATAATGG + Intergenic
1125292795 15:38168095-38168117 GAATTTAGCCAGATAAAGAGAGG - Intergenic
1125596008 15:40886506-40886528 AGGTTTAGACACATGCAGAAGGG + Intergenic
1125989598 15:44093468-44093490 GAGGCTAGTCAGGTGAAGAAGGG + Intronic
1126228165 15:46295506-46295528 GAGGTTAGAGAGTTGAGGAAGGG - Intergenic
1128515965 15:68342128-68342150 GAGTTTAGAAAAATCTAGAAGGG + Intronic
1128622780 15:69165294-69165316 AAGATTAGTCAGATGATGAAAGG - Intronic
1130265630 15:82399778-82399800 GAATTTAGGGAAATGAAGAAGGG + Intergenic
1130506384 15:84547136-84547158 GAATTTAGGGAAATGAAGAAGGG - Intergenic
1130941302 15:88511561-88511583 CAGTGGAGACAGATGAAGGAAGG - Intronic
1131761202 15:95624410-95624432 CAGTTGAGACAGAAGAAGTAAGG + Intergenic
1131775457 15:95792079-95792101 GAGAAAAGACAGAGGAAGAAAGG - Intergenic
1134335795 16:13298709-13298731 GGGTTTCGCCAGATGAAGTACGG - Intergenic
1135084808 16:19466710-19466732 GAGTTTGGACAGAGGAAGAGAGG + Intronic
1136678140 16:31933636-31933658 AATTTTAGCCAGATAAAGAAGGG + Intergenic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1137740185 16:50762180-50762202 GAGTGTGGAAAGATGAATAAAGG - Intronic
1138736469 16:59256500-59256522 GAATTTAGAGAGATGAAAGAGGG + Intergenic
1139189906 16:64850312-64850334 GAGTTTAGACAAATGTATAATGG - Intergenic
1139398025 16:66656181-66656203 GAGTTCATACAAATTAAGAAGGG + Intronic
1139869181 16:70090476-70090498 GATTTTATACAGAGGATGAAAGG + Intergenic
1140068463 16:71628693-71628715 GAGTGTAGAGAGATGAACAGGGG + Intronic
1140863144 16:79036841-79036863 TATTTTAGACACATGAAGAGAGG + Intronic
1141226461 16:82120835-82120857 TTGTTTAGACATGTGAAGAATGG + Intergenic
1141848206 16:86625770-86625792 TGTTTTACACAGATGAAGAAAGG + Intergenic
1143061770 17:4207892-4207914 GAGTTTCGGGAAATGAAGAATGG + Intronic
1143102294 17:4511192-4511214 GAGTTTGGACAGGGGAAGAGTGG + Intronic
1144209620 17:13003363-13003385 AAGTTTAGGCAGGTGCAGAAGGG + Intronic
1145775720 17:27527004-27527026 GATTTCAAACAGCTGAAGAAGGG - Intronic
1150168117 17:62964557-62964579 CACGTTAGACAGATGAAGAAAGG + Intergenic
1150440595 17:65188273-65188295 GAGTTAAGGCAGAGAAAGAAAGG - Intronic
1151317763 17:73334635-73334657 GAGTCTAGATGGATGGAGAAAGG + Exonic
1151752639 17:76049382-76049404 GGGTTTGGACAGGTGAAGAGGGG + Intronic
1153033888 18:740635-740657 GAGTTTGGACAGATTATAAAGGG + Intronic
1155861623 18:30908636-30908658 GAGTTTAGTAAGATGAAAGAAGG + Intergenic
1156616289 18:38788970-38788992 AAGTCTAGAAAGATGCAGAAAGG + Intergenic
1156952921 18:42925789-42925811 GAGTTTAGAATGATGTATAAAGG - Intronic
1157319749 18:46624812-46624834 GAGAAAAGACAGAAGAAGAAAGG - Intronic
1157553296 18:48596095-48596117 GAGATTACACAGATCATGAATGG + Intronic
1159069606 18:63608628-63608650 GAGTTTTGACAAATGAATACAGG + Intergenic
1160613750 18:80109035-80109057 GAGTTTGCACAGATGTGGAAAGG + Exonic
1161133404 19:2605167-2605189 GAGATTTGACACATGAGGAAAGG - Intronic
1162010122 19:7808110-7808132 GATCATAGACAGATAAAGAAAGG - Intergenic
1164864244 19:31590733-31590755 GAGACTAGACAGAGGAAGACAGG - Intergenic
1166882238 19:45936599-45936621 GAGTTGAGACATTTGAGGAAAGG + Exonic
925018377 2:548885-548907 GTGTTTGGGCAGATGAAGAAGGG - Intergenic
925340206 2:3130934-3130956 GGCTTTAGACAGATGAAGAGGGG + Intergenic
926359362 2:12071046-12071068 GAGTGAAGACAGCTGTAGAAAGG + Intergenic
926566147 2:14476615-14476637 GAGAGCAGACAGAGGAAGAAAGG - Intergenic
928094293 2:28394269-28394291 GAGTTATGACTGATGGAGAACGG - Intronic
929302380 2:40320653-40320675 GTGTTAAGACAAGTGAAGAATGG + Intronic
929714760 2:44298694-44298716 AAGATTAGAGAGATGAAGACTGG - Intronic
930488404 2:52037896-52037918 GAGTTTAGAAATCTGGAGAACGG - Intergenic
930610295 2:53535131-53535153 GAATTTACACATATGAAGAAAGG + Intronic
931162295 2:59705129-59705151 GAGTTTAGAGAGATGATTTAGGG - Intergenic
933147116 2:78867649-78867671 CATTTTAGGCAGATGAATAAGGG + Intergenic
933397318 2:81750029-81750051 GAGATAAGACAGAGGAGGAAAGG - Intergenic
933442408 2:82329699-82329721 GAGTATAGACAGGTAAAGAAAGG - Intergenic
935525768 2:104164668-104164690 GTGTGAAGACAGAGGAAGAAAGG - Intergenic
937872329 2:126794993-126795015 GAGTTCAGACAGAGGATGAATGG + Intergenic
937987249 2:127643506-127643528 GGGGTTTGCCAGATGAAGAAGGG + Intronic
939623469 2:144448454-144448476 GAGGTGAGACAGATGAAAAGTGG - Intronic
940475645 2:154158882-154158904 GAATTTAGAGAGATGATAAATGG - Intronic
941762170 2:169256154-169256176 TGGTTTAGACAGAAGAAGACTGG - Exonic
941941452 2:171042785-171042807 GAAATGAGACAAATGAAGAAAGG + Intronic
942710602 2:178830811-178830833 GAGTTAAGTCACATGAAGATAGG + Exonic
942873428 2:180764076-180764098 GACTTTAAACACATGAAGTAGGG + Intergenic
943509610 2:188808379-188808401 GGGTTTGGACAGATGTATAAAGG - Intergenic
943711965 2:191107134-191107156 GAGATTAGTAAGATGAAAAATGG + Intronic
944138199 2:196424273-196424295 GAGTTAGGACAGCTGAAGAGAGG - Intronic
944259183 2:197657523-197657545 CAGTTTAGAGATGTGAAGAAGGG - Intronic
944259233 2:197657964-197657986 CAGTTTAGAGATGTGAAGAAGGG + Intronic
944763710 2:202842751-202842773 GAGTTTAAGCAGAAGAAGAGAGG - Intronic
945017849 2:205538329-205538351 GAGTTTACAGGGATGAAGGATGG + Intronic
945440717 2:209875767-209875789 GTGTTTTGACTGATGGAGAATGG - Intronic
945755381 2:213839167-213839189 TAGTATTGACAGTTGAAGAATGG - Intronic
1168988788 20:2076038-2076060 GATCTTTGACAGAGGAAGAAAGG + Intergenic
1169822141 20:9723207-9723229 AAGTTTGCACAGGTGAAGAATGG + Intronic
1170295164 20:14816517-14816539 CAATTTATACAGATGAAAAATGG - Intronic
1172430052 20:34882647-34882669 AAGATTAGACAGGTAAAGAAGGG + Intronic
1174165321 20:48579944-48579966 GACTTGAGCCAGATGAAGGAAGG + Intergenic
1178159330 21:29893739-29893761 GAGTCTAGGCAGATGATGTAAGG + Intronic
1178488782 21:33034800-33034822 GAGTTTAGACAGTTCTAGAAAGG + Intergenic
1181416419 22:22762613-22762635 AAGATGAGACAGATGAAAAATGG - Intronic
1181482155 22:23206981-23207003 GATGTTAGACAGATGATGGATGG - Intronic
1181848068 22:25729420-25729442 GATTTTAAATAGAGGAAGAAGGG + Intergenic
1182111792 22:27728952-27728974 GAGTTTCAACAGCTGGAGAAAGG - Intergenic
1183786936 22:40034896-40034918 CACTTAGGACAGATGAAGAAAGG - Exonic
1185328526 22:50240026-50240048 GAGTTAAGAGAGATGCAGAGGGG - Intronic
949637206 3:5995988-5996010 GAGTTTTGATATATGAAGATGGG - Intergenic
949710286 3:6863171-6863193 GAGTGAAGACAGAGGAGGAAAGG - Intronic
949840784 3:8317461-8317483 GAGGAAAGAAAGATGAAGAAGGG - Intergenic
949978931 3:9487704-9487726 GAGTTTTGACAAATGTATAATGG - Intergenic
950761505 3:15233498-15233520 GAGTTTAGAGAGAGAAAGAATGG + Intronic
951898939 3:27637762-27637784 GAATTAAGAAAGAAGAAGAAAGG + Intergenic
955645921 3:61137328-61137350 GGATTTAGCCATATGAAGAAGGG - Intronic
955762098 3:62297507-62297529 TAGTTTAAACAGAAGAAAAAGGG - Exonic
957932069 3:86892865-86892887 GAGCTCACCCAGATGAAGAAGGG + Intergenic
959307589 3:104689010-104689032 GAGTAGAGACAGCAGAAGAAAGG - Intergenic
959850462 3:111080948-111080970 GAGTTTAGACAGATAAAACAGGG + Intronic
960393980 3:117113930-117113952 GAGTATAGACTCATTAAGAATGG - Intronic
960655522 3:119999747-119999769 GAATTTAGACAGCAGGAGAATGG + Intronic
961742305 3:129040434-129040456 GGATTTAGACAGGTAAAGAAAGG + Exonic
961801925 3:129457516-129457538 GAGCTTAGCCAGATGTAGAGAGG - Intronic
962543552 3:136408804-136408826 AAGTCTAGACAGATAAAAAATGG + Intronic
962727768 3:138250123-138250145 AAGTGTAGACAGAAGAAAAAAGG + Intronic
965029635 3:163348643-163348665 GAGTTTTGACAAATGAATAGTGG - Intergenic
965120681 3:164551481-164551503 GGGGTTAAACAGATGAAGAGTGG + Intergenic
965178563 3:165368213-165368235 TAGTTTTTACAGATGATGAATGG - Intergenic
967186231 3:186946982-186947004 GAGTTTTGATAGGTGGAGAATGG + Intronic
967732843 3:192921864-192921886 GAATTTTGACAGATGGACAAAGG + Intergenic
968893112 4:3382734-3382756 GAGATTAGGCAGTTGAAGAGAGG - Intronic
970333937 4:15012506-15012528 GAGTCTAGTTAGATGAATAAGGG + Intronic
970625807 4:17879503-17879525 GCCTCTAGACAGATGAAGATAGG + Intronic
970825186 4:20263682-20263704 AAGTTTTGAAAGATGAAGCAAGG - Intronic
971864330 4:32149775-32149797 CAATTCAGAAAGATGAAGAATGG + Intergenic
971944406 4:33255317-33255339 GAGTTTGGACAGGCGAGGAATGG + Intergenic
971991701 4:33906493-33906515 GGGTTTGGACAGATAAATAATGG - Intergenic
972814880 4:42633237-42633259 GAATCTGGGCAGATGAAGAAAGG - Intronic
972969743 4:44558852-44558874 GAGTTGAGATGGGTGAAGAATGG - Intergenic
973531469 4:51841057-51841079 GAGTTAAGCTAGATGAAGGATGG - Intergenic
974785350 4:66612684-66612706 GAGTTTGGAGAGATTTAGAATGG + Intergenic
975726226 4:77294316-77294338 GAGTTTCTACTGAGGAAGAAGGG - Intronic
975906951 4:79224719-79224741 GAATTTTGAGAGATGAAGAATGG + Intergenic
976673373 4:87678195-87678217 GAATTTACATAGATGCAGAAAGG + Intergenic
977548192 4:98410877-98410899 GATTTGAGACAAATGAAGGAAGG + Intronic
978987494 4:115031526-115031548 GAGTTCAGAGAGAAGAAGACTGG - Intronic
979913668 4:126404124-126404146 GAGTTAACTCAGGTGAAGAAAGG - Intergenic
980601025 4:135024921-135024943 GGGATTAATCAGATGAAGAAGGG - Intergenic
981075791 4:140590266-140590288 GAGATGAGACAGTTGAAGATAGG + Intergenic
983004174 4:162462567-162462589 CAGTTAAGACAGTTGAAGCAGGG - Intergenic
983028343 4:162765914-162765936 GTGGTTAGCAAGATGAAGAAAGG - Intergenic
984217699 4:176934824-176934846 GAGTTTCAACATATGAAGATTGG + Intergenic
984556545 4:181220380-181220402 GTCTTTAGAAAGTTGAAGAATGG + Intergenic
985185961 4:187315982-187316004 GAGTTAACACAGGTGAAGAGGGG - Intergenic
987765288 5:22219790-22219812 GAGTTTTCTCAGATGAAAAAAGG + Intronic
990232807 5:53733100-53733122 GAGTTTTTACTGAAGAAGAAGGG + Intergenic
991431128 5:66548705-66548727 GAGTTTATACAGAGTAAGAGTGG - Intergenic
991443870 5:66679554-66679576 GAGAGTATACAAATGAAGAAGGG - Intronic
992103883 5:73434405-73434427 CAATTTAGATAGATAAAGAATGG - Intergenic
992120999 5:73592087-73592109 GAGGATAGGGAGATGAAGAAAGG - Intergenic
992525621 5:77607329-77607351 GATGTGAGACAGAAGAAGAAGGG + Intronic
992878299 5:81079714-81079736 GAGTTTTGACAGAAGGAGAGAGG - Intronic
993302272 5:86225941-86225963 GAGCTAAGAGAGATGAAGTAGGG + Intergenic
993814297 5:92522259-92522281 TAGTTCAAACATATGAAGAATGG - Intergenic
994168858 5:96637555-96637577 GACATTAAACAGATGAAGACTGG + Intronic
995174377 5:109158013-109158035 GGATTTAGCTAGATGAAGAAGGG + Intronic
995763194 5:115586156-115586178 GAGTATAGATAGAAAAAGAAAGG + Intronic
997448412 5:133961102-133961124 GAGTGTATTCACATGAAGAAAGG - Intronic
997733410 5:136196561-136196583 GAGTTCAGACAATTGAAGATTGG + Intergenic
998808959 5:145946691-145946713 GAGTTTAGTCATATGCAGAGTGG - Intronic
999043435 5:148442046-148442068 GAGATGCGTCAGATGAAGAAGGG + Exonic
999824764 5:155263507-155263529 AAGTTTAGGCAGATAAAGAATGG - Intergenic
1001320272 5:170674991-170675013 AATTTTAGACAGATGCTGAAAGG - Intronic
1004014229 6:11717817-11717839 GAGTTTAGGGAGATGAAGTTAGG + Intronic
1005601130 6:27427227-27427249 GTTCTTAGACAGATGGAGAACGG + Intergenic
1006281589 6:33058631-33058653 GAGTGTAGAGAGATGAGCAAAGG - Intergenic
1007118459 6:39361248-39361270 GAGTAGAGACACAAGAAGAATGG + Intronic
1007476131 6:42121354-42121376 GAGTTGAGAAGGAGGAAGAAAGG + Intronic
1008060072 6:46987752-46987774 GGGGGAAGACAGATGAAGAAAGG - Intergenic
1010451659 6:76010835-76010857 CAGTAGAGACAGATGAAAAAAGG - Intronic
1011538447 6:88403818-88403840 GAAATTAAACAGATGGAGAAGGG - Intergenic
1012221231 6:96651832-96651854 AAGCTTATACAGAAGAAGAAGGG - Intergenic
1012601704 6:101106329-101106351 GAGTTTTAAAAGATGAAGAAAGG + Intergenic
1012658302 6:101854012-101854034 GAGTTTTGACAAATGTATAATGG - Intronic
1012857886 6:104524903-104524925 AAGTATAGACAGATCAACAATGG + Intergenic
1013616446 6:111847511-111847533 GAGTTAAGAAATATGAAAAAAGG + Intronic
1013691137 6:112645690-112645712 GTGTTTAGTCAGCTGTAGAATGG - Intergenic
1014296951 6:119630123-119630145 GAGTGGAGAGAGATAAAGAAAGG + Intergenic
1015089766 6:129341442-129341464 GAGTTGAGAAAAAGGAAGAAGGG - Intronic
1015319951 6:131861845-131861867 GAGTTTAGATAGATGGTAAATGG + Intronic
1017323599 6:153120847-153120869 GAATTTTGACAGACAAAGAAAGG - Intronic
1019047771 6:169161574-169161596 GAGTTTGGACAGCTGGAGGATGG - Intergenic
1020411359 7:7895393-7895415 GACTTTAGACAGGTCCAGAATGG + Intronic
1022656784 7:32326636-32326658 GAGTTTATACAGAGGACAAAAGG + Intergenic
1022711961 7:32859657-32859679 GAGTCTAGAAAGATGAAGAGAGG - Intergenic
1022912555 7:34913785-34913807 GAGTCTAGAAAGATGAAGAGAGG + Intergenic
1023099072 7:36694885-36694907 GAGGATAGACAGATGATGGATGG + Intronic
1024144275 7:46496295-46496317 AAGTTTAGACAAATGTATAATGG - Intergenic
1029634188 7:101772972-101772994 GAGTGGAGACAGATGATGGACGG + Intergenic
1031452136 7:121935394-121935416 CAGCTCAGACAGAAGAAGAAGGG - Intronic
1031930338 7:127679021-127679043 GGGTTGTGACAGTTGAAGAATGG + Intronic
1034909973 7:154987870-154987892 GAGTTTTGACAAATGGAGATGGG - Intronic
1036018363 8:4812984-4813006 GAGTTTTAACAGATAAATAAGGG - Intronic
1036193792 8:6696453-6696475 TAGAATAGACATATGAAGAAAGG - Intergenic
1037120317 8:15277348-15277370 GGGTTTAGACAAATGTATAATGG - Intergenic
1038581946 8:28755429-28755451 ACGTCAAGACAGATGAAGAAAGG - Intronic
1038932040 8:32204177-32204199 GAGGTCAGAAAGATGAGGAAAGG + Intronic
1040958024 8:52999967-52999989 GATTTTAGGCAGATGAGAAAAGG - Intergenic
1042009531 8:64226069-64226091 GCGTTTAGACAGCAGATGAAAGG - Intergenic
1042467924 8:69149449-69149471 GAGTAGATAGAGATGAAGAAAGG + Intergenic
1043649586 8:82574583-82574605 GAGTTTAGAAAGATGATAAGTGG + Intergenic
1043673786 8:82923276-82923298 GAGATTAGAGAGATGAGGAGAGG - Intergenic
1044755176 8:95454107-95454129 GAGTGTAGAGAGAAGAGGAATGG - Intergenic
1045742356 8:105376145-105376167 GAGTTAAGAGAGGTGAAGATTGG - Intronic
1046068451 8:109222861-109222883 GAGTACAGACAGAAGATGAATGG - Intergenic
1046403169 8:113734593-113734615 GACTTTTAACAGATGAATAAAGG + Intergenic
1047033017 8:120904117-120904139 GAGTATACACAGATGAATAAGGG + Intergenic
1051046589 9:12882761-12882783 TAGTTTATACAGATGTAGGAAGG - Intergenic
1051158710 9:14181367-14181389 GACTCGAGCCAGATGAAGAATGG - Intronic
1051752163 9:20353924-20353946 GAGTTTAAACATATTAACAAAGG + Intronic
1052515894 9:29479076-29479098 GAGTATAGATAGATGGAAAAAGG - Intergenic
1052691130 9:31818286-31818308 GACTTGAGACAGAAGAGGAATGG - Intergenic
1054963734 9:70998555-70998577 GGGTTTAGACAAATCTAGAATGG + Intronic
1056476628 9:86959008-86959030 GAGTTTGGTCAGATACAGAATGG - Intergenic
1058368071 9:104234155-104234177 GAATATAGACAGGTAAAGAAAGG - Intergenic
1058481649 9:105401980-105402002 GGGATTAGCCAGATGATGAAGGG + Intronic
1058615778 9:106826364-106826386 GGATTTAGACAAGTGAAGAATGG + Intergenic
1058875419 9:109239938-109239960 GAGTTGCCCCAGATGAAGAAAGG + Intronic
1059064285 9:111066356-111066378 GAGAAAAGAGAGATGAAGAAAGG - Intergenic
1059195982 9:112371425-112371447 GAGTTGAAACAGATGAATTAGGG - Intergenic
1059952372 9:119479270-119479292 GGGTTTAGACAAATGTATAATGG - Intergenic
1059985619 9:119817774-119817796 GAGTTGGGAAAGAAGAAGAAGGG - Intergenic
1185954816 X:4478071-4478093 AAGAAGAGACAGATGAAGAAAGG + Intergenic
1186880154 X:13857046-13857068 GAGATTAGAAAGATAAAGATCGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187925011 X:24241800-24241822 TATTTTAGCCATATGAAGAAAGG + Intergenic
1188062028 X:25612710-25612732 GAGTTTAGTCAGTTGGAGAATGG - Intergenic
1189048915 X:37622800-37622822 GAGTATAGGCAGTTGGAGAAGGG - Intronic
1190013498 X:46805874-46805896 GAGTTTAGAGAGATGACCAGGGG - Intergenic
1190425459 X:50331089-50331111 GAAATTAGAAAGATGATGAATGG - Intronic
1190726559 X:53193995-53194017 GAATCTGGACAGATGCAGAATGG + Intronic
1190773151 X:53531799-53531821 GTTTTGTGACAGATGAAGAAAGG - Intergenic
1191970492 X:66809868-66809890 GAGTTTAAGGAGATGAAGCAAGG - Intergenic
1192547028 X:72022672-72022694 GGGTTTCAACATATGAAGAAGGG + Intergenic
1193876111 X:86864498-86864520 GAATTTAGAGAGATGATGATTGG + Intergenic
1194495045 X:94604444-94604466 GAATTTAGCCAGAGGAAGAGAGG + Intergenic
1196286543 X:113887750-113887772 GAGTATAGACAGTAGAAGGATGG - Intergenic
1197212218 X:123837442-123837464 GAGTTTGGACAAATGAATAATGG + Intergenic
1197390846 X:125861930-125861952 GAATTTAGAAAAATGAACAAAGG + Intergenic
1198069116 X:133130463-133130485 CAGCCAAGACAGATGAAGAAAGG + Intergenic
1199338519 X:146647792-146647814 GAGTTTAGAAAGTTGAAAAGAGG + Intergenic
1201231316 Y:11867456-11867478 GAGTATAGAAAGAGGTAGAAGGG + Intergenic
1201592061 Y:15626397-15626419 GTGTCTAGACAGATAGAGAATGG - Intergenic