ID: 1075746903

View in Genome Browser
Species Human (GRCh38)
Location 10:124734414-124734436
Sequence CAAGGAGGACACAGTGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075746893_1075746903 29 Left 1075746893 10:124734362-124734384 CCACCACCATGGCAGGTATGTTT 0: 1
1: 0
2: 0
3: 16
4: 365
Right 1075746903 10:124734414-124734436 CAAGGAGGACACAGTGGGTGAGG No data
1075746895_1075746903 23 Left 1075746895 10:124734368-124734390 CCATGGCAGGTATGTTTTGTGCT 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1075746903 10:124734414-124734436 CAAGGAGGACACAGTGGGTGAGG No data
1075746894_1075746903 26 Left 1075746894 10:124734365-124734387 CCACCATGGCAGGTATGTTTTGT 0: 1
1: 0
2: 3
3: 32
4: 566
Right 1075746903 10:124734414-124734436 CAAGGAGGACACAGTGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075746903 Original CRISPR CAAGGAGGACACAGTGGGTG AGG Intronic
No off target data available for this crispr