ID: 1075747589

View in Genome Browser
Species Human (GRCh38)
Location 10:124738459-124738481
Sequence GAGTTTGTAGGAGCGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075747589_1075747598 11 Left 1075747589 10:124738459-124738481 CCCCAGCACGCTCCTACAAACTC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1075747598 10:124738493-124738515 AAAGGACAGCATGCCTGGCCAGG No data
1075747589_1075747602 30 Left 1075747589 10:124738459-124738481 CCCCAGCACGCTCCTACAAACTC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1075747602 10:124738512-124738534 CAGGCAGGCCTTGCTAGAGATGG No data
1075747589_1075747596 -7 Left 1075747589 10:124738459-124738481 CCCCAGCACGCTCCTACAAACTC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1075747596 10:124738475-124738497 CAAACTCTTCAGGGGCAGAAAGG No data
1075747589_1075747597 6 Left 1075747589 10:124738459-124738481 CCCCAGCACGCTCCTACAAACTC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1075747597 10:124738488-124738510 GGCAGAAAGGACAGCATGCCTGG No data
1075747589_1075747599 15 Left 1075747589 10:124738459-124738481 CCCCAGCACGCTCCTACAAACTC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1075747599 10:124738497-124738519 GACAGCATGCCTGGCCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075747589 Original CRISPR GAGTTTGTAGGAGCGTGCTG GGG (reversed) Intronic
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
901642263 1:10698749-10698771 CAGTTTGGAGGAGCTCGCTGGGG - Intronic
902393101 1:16117521-16117543 GAGCTGGTAAGATCGTGCTGAGG + Intergenic
905373484 1:37501083-37501105 GGGTTTGTATGATCATGCTGGGG - Intronic
910214618 1:84830521-84830543 AAGTGTGTAAGAGTGTGCTGTGG - Intronic
910502457 1:87908622-87908644 GAGTTAGTTGCAGAGTGCTGTGG + Intergenic
913326036 1:117629765-117629787 GAGATTTTAGAAGCCTGCTGTGG - Intergenic
917338218 1:173947383-173947405 GATTTTGTAGGAGCTCCCTGAGG + Exonic
1063985354 10:11495994-11496016 GAGATTGGAAGAGCGTTCTGTGG - Intronic
1071737631 10:88318871-88318893 GATTTTGTTGGAGCATGCTGAGG - Intronic
1075747589 10:124738459-124738481 GAGTTTGTAGGAGCGTGCTGGGG - Intronic
1079135712 11:17775064-17775086 GAGTTTGTGGGAGAGTGAGGGGG + Intronic
1081656043 11:44858273-44858295 GAGATGGTAGCAGGGTGCTGTGG - Intronic
1086966935 11:93038076-93038098 GAGTTTGCTGGAGGGTGCTGTGG + Intergenic
1087022325 11:93615891-93615913 GTCTTTGTAGCAGGGTGCTGTGG + Intergenic
1090766500 11:129880577-129880599 GAGTTTGGAGGACCTTCCTGAGG - Intronic
1092126009 12:6075431-6075453 GACTTTGTGTGAGTGTGCTGGGG - Exonic
1092312197 12:7369705-7369727 GAGGTTGTGGGAGAATGCTGAGG + Intronic
1093384111 12:18530116-18530138 GAGTTGGTAGGAGTGATCTGAGG - Intronic
1094866904 12:34545026-34545048 GAGTATGTGGGAGCATACTGAGG - Intergenic
1096687893 12:53300812-53300834 TAGTTGGTAGGAGGGAGCTGAGG - Intronic
1104713510 12:131002450-131002472 GTGTTTGTGGGAGAATGCTGAGG + Intronic
1106916827 13:34524715-34524737 GAGTTTGTAGGAGTTGGGTGAGG - Intergenic
1110309804 13:74036062-74036084 GAGTGTATAGGAGCATTCTGAGG - Intronic
1111614619 13:90646689-90646711 AAGTGTGTAGGAGAGTGTTGAGG - Intergenic
1112378742 13:98868474-98868496 GAGTTTCTAGCTGGGTGCTGTGG + Intronic
1120297739 14:82664999-82665021 GGATTAGTAGGAGTGTGCTGGGG + Intergenic
1122875297 14:104661291-104661313 GAATGTGAAGGAGAGTGCTGTGG - Intergenic
1123774789 15:23567297-23567319 GATTCTGTAGCATCGTGCTGTGG + Exonic
1132229567 15:100171489-100171511 GATGTTGTGGGAGCGTGCAGGGG - Intronic
1139565702 16:67774476-67774498 GAGTCTGTAGGAAGGTGTTGAGG - Intronic
1143447805 17:7019299-7019321 AGGTTTGGAGGTGCGTGCTGGGG - Intergenic
1151562309 17:74877184-74877206 GAATTTGTAGGAGGGGGCTGGGG - Intergenic
1153908794 18:9688147-9688169 GAGTTTATTGGCACGTGCTGAGG + Intergenic
1156991933 18:43419593-43419615 GAGTATGAAGGTGCCTGCTGGGG + Intergenic
1158370740 18:56800634-56800656 CAGTTATTAGGAGCCTGCTGAGG - Intronic
1161885116 19:6988548-6988570 GAGTTTGTAGGATTGTTGTGGGG + Intergenic
1161977348 19:7613773-7613795 GGGGTGGTAGGAGCGTGCTGGGG - Intronic
1164907422 19:31978654-31978676 GAGATTATAGGAGGGGGCTGGGG - Intergenic
925465240 2:4102112-4102134 CAGTGTGTGGGAGCATGCTGTGG + Intergenic
926915104 2:17883718-17883740 GAGGTTGTAGAAGAGGGCTGGGG + Intronic
927341136 2:21983942-21983964 GAGTTTGTAGGAGACTGATATGG - Intergenic
928185102 2:29102953-29102975 GAGTTTTAGGGAGGGTGCTGAGG - Intronic
931620999 2:64209420-64209442 GAGTTGGTATGTGGGTGCTGTGG - Intergenic
933214623 2:79615824-79615846 GTGTTTGTATGTGCGTGTTGGGG + Intronic
934046303 2:88175392-88175414 GTGTTTGGAGGTGTGTGCTGAGG + Exonic
935310648 2:101779679-101779701 GAGTTTGCATGAGAGTGCTCTGG + Intronic
936611543 2:114006576-114006598 GTGTTTGCAGAAGTGTGCTGTGG - Intergenic
948932243 2:241139487-241139509 GTGTTTGTGGGAGCGGGCGGGGG - Intronic
1173087550 20:39938654-39938676 GAGTTTGTGGGAGCCAGCTAGGG - Intergenic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175855597 20:62119255-62119277 GTGTATGTAGGAGCATGCCGTGG - Intergenic
1176515265 21:7779100-7779122 GAGTTTCTAAGAGCATCCTGGGG + Intergenic
1178649293 21:34409112-34409134 GAGTTTCTAAGAGCATCCTGGGG + Intergenic
1180868747 22:19134343-19134365 GAGGTGGGTGGAGCGTGCTGGGG + Exonic
1181003226 22:19997780-19997802 AAGTTTGTAGGAGTGTGGAGAGG + Intronic
951450055 3:22827183-22827205 GAGTTTGCTGGAGTTTGCTGTGG - Intergenic
955512829 3:59698497-59698519 GAGATTGGGGGAGAGTGCTGTGG + Intergenic
957281503 3:78155840-78155862 GAGGTTGTAGGAACTAGCTGTGG - Intergenic
958466212 3:94462368-94462390 GAGTTTGTGTGTGCATGCTGGGG + Intergenic
959662962 3:108889726-108889748 GAGTTTGTAGCAACATGCAGTGG + Intergenic
968664181 4:1811667-1811689 GGGCTAGCAGGAGCGTGCTGGGG - Exonic
978187635 4:105875805-105875827 GTGTATGTATGAGCATGCTGGGG - Intronic
980790187 4:137610219-137610241 GAGGAGGTAGGAGCGGGCTGTGG + Intergenic
984581226 4:181512025-181512047 GCCTTTGTAGGACTGTGCTGAGG - Intergenic
985785593 5:1892248-1892270 GAGGTTGTAGGAGGGTCCTGGGG + Intergenic
988460435 5:31431887-31431909 GAGTTTGTAGAAGCCTGTTTGGG - Intronic
990473863 5:56142798-56142820 AAGTATGTAGGAGGGTGCTATGG + Intronic
992205775 5:74429282-74429304 GGGTTTGGAGGAGGGTCCTGGGG - Intergenic
994504221 5:100620087-100620109 GAGTTTGTAGCAGTTTGCTAAGG + Intergenic
1002074160 5:176698207-176698229 GAGTTTGGAGAAGCTGGCTGGGG + Intergenic
1002190589 5:177475374-177475396 GAGTTTGTAGGTGGCTGGTGGGG - Intergenic
1003161887 6:3643114-3643136 GAGTTTGTAAGTGCCTGCTGGGG - Intergenic
1003580393 6:7334858-7334880 GAGGTTGTATGAGCTTCCTGTGG + Intronic
1005431827 6:25765365-25765387 CATTTTGTAGGAGCCTGCTCAGG + Intronic
1006910824 6:37562457-37562479 GTGGTTCTAGGAGGGTGCTGGGG + Intergenic
1008289503 6:49696475-49696497 GTGTTTGTAGGAGTGTGCTTAGG + Intronic
1008747695 6:54692811-54692833 CAGTAAGTAGGAGGGTGCTGAGG - Intergenic
1015550015 6:134402473-134402495 GAGTTTGCAGGGCAGTGCTGAGG - Intergenic
1016128736 6:140438583-140438605 GAGCTTGTAGAACAGTGCTGAGG + Intergenic
1017728425 6:157292723-157292745 GAGTATGTGTGTGCGTGCTGGGG - Exonic
1036597651 8:10228519-10228541 GGGTTTGAAGGATGGTGCTGTGG - Intronic
1038342135 8:26695308-26695330 GAGGTTGTAGGAGTGGACTGAGG + Intergenic
1038861867 8:31396563-31396585 GAGTTTATAGGAGAGGGATGCGG - Intergenic
1047518774 8:125578394-125578416 GAGCTGGTAGGTGGGTGCTGGGG - Intergenic
1048548733 8:135413791-135413813 GAGTTTGGATGAGAGTGCAGTGG + Intergenic
1049911429 9:272262-272284 GAGATTGTAAAAGCGCGCTGGGG - Intronic
1057700344 9:97359554-97359576 GAGTGTGTAGGAGAGTGATCTGG - Intronic
1061804703 9:133131454-133131476 GAGTTAGTAGGAGGGGGCTGTGG - Intronic
1062181748 9:135194647-135194669 GTGTTTGCAGAAGCCTGCTGAGG - Intergenic
1187463429 X:19507739-19507761 GAGTTTGTGGGAGAGGGCAGAGG + Intronic
1194027056 X:88765057-88765079 GATTGTGTTGGAGTGTGCTGAGG - Intergenic