ID: 1075748381

View in Genome Browser
Species Human (GRCh38)
Location 10:124743776-124743798
Sequence CTCGGTCTCGCCCCTGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075748381_1075748391 20 Left 1075748381 10:124743776-124743798 CCTGCATCAGGGGCGAGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1075748391 10:124743819-124743841 CCCAACCCAAAGGCGAAACAAGG 0: 1
1: 0
2: 0
3: 8
4: 119
1075748381_1075748386 10 Left 1075748381 10:124743776-124743798 CCTGCATCAGGGGCGAGACCGAG 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1075748386 10:124743809-124743831 AACCGCCCGACCCAACCCAAAGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075748381 Original CRISPR CTCGGTCTCGCCCCTGATGC AGG (reversed) Intronic
900924054 1:5692024-5692046 CTCGCTCTTGCCCCTGGTGTTGG + Intergenic
902409911 1:16206595-16206617 CCAGGTCCCGCCCCTGATCCTGG + Intronic
906107754 1:43304960-43304982 CTGGGGCCCGCCCCTGCTGCTGG + Exonic
906203669 1:43975537-43975559 CTCGGTCCCGCCTCGGATTCGGG + Intronic
915129414 1:153686611-153686633 CTCTGTCAAGCTCCTGATGCTGG + Intronic
915552216 1:156641949-156641971 CTTGCTCTCGCCGCTGCTGCCGG + Exonic
1063063117 10:2578477-2578499 CGCTGACTCGCCCCTGGTGCCGG + Intergenic
1071520707 10:86330091-86330113 CACGGTCTCGTCCATGATACAGG - Intronic
1073836749 10:107453073-107453095 CTCAGTCACGCCCCTGAGGAAGG + Intergenic
1075748381 10:124743776-124743798 CTCGGTCTCGCCCCTGATGCAGG - Intronic
1076692802 10:132232373-132232395 CTCCCTCGGGCCCCTGATGCAGG + Intronic
1078390811 11:10933964-10933986 CTCGGACTAGCCCCGGCTGCTGG - Intergenic
1083814885 11:65127056-65127078 CTTGGTCTCTGCCCTGAAGCAGG + Exonic
1088585242 11:111355381-111355403 CCAGGTCCCGCCCCTGTTGCAGG - Intronic
1096532998 12:52253619-52253641 CTCGGCCTCGGCCCGGCTGCGGG + Intronic
1096538076 12:52288002-52288024 CTCGGCCTCGGCCCGGCTGCGGG + Exonic
1102968521 12:117147759-117147781 CTGGGTGTGGCCCCTGATGCAGG + Intronic
1113944494 13:114036218-114036240 CTCTGACCCTCCCCTGATGCAGG - Intronic
1114493924 14:23119695-23119717 CTCTGGCTCTCCCCTGCTGCTGG + Intergenic
1119236926 14:73027241-73027263 CGCGCTCTCGCCCCTCATCCCGG + Intergenic
1123037024 14:105475683-105475705 CTCGGTCTAGCCCCTCCGGCAGG + Intronic
1202903904 14_GL000194v1_random:57808-57830 CTCAGTCCTGGCCCTGATGCTGG - Intergenic
1127384701 15:58457870-58457892 CTCCATCCTGCCCCTGATGCTGG + Intronic
1132153260 15:99477061-99477083 CGCGGTCTCCCCGCTGCTGCAGG - Intergenic
1135994731 16:27239317-27239339 CCTGGTCTCTCCCCTGATCCAGG + Intronic
1136187309 16:28595934-28595956 CTGGCTCTGGCCCCTGACGCAGG - Exonic
1136189790 16:28608859-28608881 CTGGCTCTGGCCCCTGACGCAGG - Exonic
1136317196 16:29461360-29461382 CTGGCTCTGGCCCCTGATGCAGG + Exonic
1136431771 16:30200703-30200725 CTGGCTCTGGCCCCTGATGCAGG + Exonic
1142135524 16:88450263-88450285 CTCAGCCCTGCCCCTGATGCTGG - Intergenic
1142638220 17:1270691-1270713 CTCCGCCTCGCCCCGGCTGCAGG - Exonic
1150938354 17:69661752-69661774 CTCGCTCTTGCCCCCCATGCTGG - Intergenic
1151420132 17:73991541-73991563 CTGGGTCTCTCCCCTGCAGCTGG + Intergenic
1159138295 18:64362396-64362418 CTCGGTCACTCCCATGATGTGGG + Intergenic
1160372825 18:78389133-78389155 GCCGGTCTCGCCCATGATGGGGG + Intergenic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1164676929 19:30107234-30107256 CTCAGTGTCGCCCCTGCAGCAGG + Intergenic
1166388953 19:42398136-42398158 CTCGGCCTCTTCCCTGATCCAGG - Intergenic
1167854338 19:52225965-52225987 TTCTGTCTCTCGCCTGATGCTGG + Exonic
932470140 2:71949644-71949666 TTCGGCCCCTCCCCTGATGCGGG + Intergenic
940910596 2:159206366-159206388 CTGGGTTTTGCCCCTGATGTGGG + Intronic
944910394 2:204305196-204305218 CTAGGTCTGGCCCCACATGCTGG - Intergenic
946653648 2:221921084-221921106 CTCGACCTCCCTCCTGATGCTGG + Intergenic
948772097 2:240256788-240256810 CTCACTGTCGCCCCTGATGGTGG - Intergenic
949048031 2:241881184-241881206 CTCTGTCCCGCCCCTCCTGCAGG - Intergenic
1173835687 20:46123743-46123765 CTCTGTCTCTCCCCTCCTGCTGG + Intronic
1174251192 20:49220730-49220752 CCCGGTCACACCCATGATGCGGG + Intronic
1175917144 20:62431564-62431586 CTGGGTCTCGCTCCTGTTCCTGG + Intergenic
1176623274 21:9072576-9072598 CTCAGTCCTGGCCCTGATGCTGG - Intergenic
1181521694 22:23452064-23452086 CTCGGTGTCTCCCCTGAGCCCGG + Intergenic
1184400248 22:44269817-44269839 CTCCGCCTCTCCCCTGGTGCTGG + Intronic
1185316607 22:50182014-50182036 CTCGCTGTCGCCCATGCTGCTGG - Intergenic
949403301 3:3688182-3688204 CTGGGTCTTTCCCCTGATGTGGG - Intergenic
962294820 3:134173663-134173685 CTTGGTCTCGCCCTTGACGTGGG + Intronic
966787930 3:183636832-183636854 CGCGCTCCCGCCCCTGCTGCGGG + Intronic
967830971 3:193920030-193920052 CTCGGTCCAGCCCTTGGTGCAGG + Intergenic
975288046 4:72643253-72643275 CTCGGCCACGCCGCTGATGTTGG + Intergenic
981920539 4:150079815-150079837 CTCGGTGTGGACCCTGGTGCAGG + Intronic
996790778 5:127290781-127290803 CTCTGTCTGGCCCGAGATGCTGG - Intergenic
997615816 5:135245579-135245601 CTGGGGCTGGCCTCTGATGCTGG - Intronic
1000019039 5:157303128-157303150 CACGTTCTCAACCCTGATGCAGG - Intronic
1018167033 6:161107926-161107948 CCCGGTGTCGACGCTGATGCAGG - Exonic
1025023254 7:55496331-55496353 CTGGGTCTTGCCCCTGACACTGG + Intronic
1027631394 7:80610605-80610627 CTCTGTCTCGCCCAGGCTGCAGG + Intronic
1036684844 8:10902815-10902837 ATCATTCTCGCCCCTGTTGCTGG - Intronic
1037711409 8:21358310-21358332 CTCAGGCTCACCCCTGAGGCAGG + Intergenic
1044088555 8:87971528-87971550 CTCCGCCGCGGCCCTGATGCGGG + Intergenic
1048790645 8:138100368-138100390 CTGGGTCTCCCCCATGATGTGGG + Intergenic
1054172713 9:61856027-61856049 CTCGGATTCGCCCCTGTTCCTGG + Intergenic
1054664827 9:67724774-67724796 CTCGGATTCGCCCCTGTTCCTGG - Intergenic
1203746460 Un_GL000218v1:43003-43025 CTCAGTCCTGGCCCTGATGCTGG - Intergenic
1203563645 Un_KI270744v1:76477-76499 CTCAGTCCTGGCCCTGATGCAGG + Intergenic
1197314259 X:124945141-124945163 CTCGGTCTCTTGCCTGATGCAGG - Intronic
1201159792 Y:11158017-11158039 CTCAGTCCTGGCCCTGATGCTGG - Intergenic