ID: 1075753227

View in Genome Browser
Species Human (GRCh38)
Location 10:124791310-124791332
Sequence GAGTAGGAGGGGAGGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1031
Summary {0: 1, 1: 0, 2: 5, 3: 72, 4: 953}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075753227_1075753236 -4 Left 1075753227 10:124791310-124791332 CCCACATCCCTCCCCTCCTACTC 0: 1
1: 0
2: 5
3: 72
4: 953
Right 1075753236 10:124791329-124791351 ACTCAGCCTTTTCGGCTCCCAGG No data
1075753227_1075753240 15 Left 1075753227 10:124791310-124791332 CCCACATCCCTCCCCTCCTACTC 0: 1
1: 0
2: 5
3: 72
4: 953
Right 1075753240 10:124791348-124791370 CAGGCCCAGCACTTCTCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075753227 Original CRISPR GAGTAGGAGGGGAGGGATGT GGG (reversed) Intronic
900166089 1:1244899-1244921 GAGGAGGAGGAGGGGGAGGTGGG - Intronic
900166225 1:1245232-1245254 GGGGAGGAGGGGAGAGGTGTGGG - Intronic
900391497 1:2435937-2435959 GAGGAGGAGAGGAGGGAGGAAGG - Intronic
901155869 1:7137815-7137837 GAGATGGAGAGAAGGGATGTGGG - Intronic
901226189 1:7614067-7614089 GGGTGGGAGGAGAGGGATGGTGG + Intronic
901688288 1:10956799-10956821 GTGGAGTAGGGGTGGGATGTGGG - Intronic
901877274 1:12174009-12174031 GAGTGCGGGGGGAGGGCTGTTGG + Intronic
902759016 1:18568725-18568747 GAGAAGGAGGGAAGGGAGGAAGG + Intergenic
902791344 1:18770319-18770341 GAGTAGGGAGGGTGGAATGTAGG - Intergenic
903572364 1:24315628-24315650 GGAAAGGAGGGGAGGGATGAAGG + Intergenic
903790297 1:25888245-25888267 GAGTGGGTGAGGAGGGCTGTGGG + Intronic
903947462 1:26972668-26972690 GAGGAGGATGGAAGGGATGGAGG + Intergenic
903995664 1:27304055-27304077 GAGAAGGAGGTGGGGGATGAAGG - Intronic
904051208 1:27640123-27640145 GAGGAGAAGGGGTAGGATGTTGG - Intergenic
904232029 1:29082585-29082607 GGGTAGGGGTGGAGGGATGAAGG - Intronic
904277487 1:29393922-29393944 GGGGAGGAGGGGAGGGAGGGAGG - Intergenic
904286774 1:29458023-29458045 GAATGGGAGGGGAAGGAGGTGGG - Intergenic
904432946 1:30476904-30476926 GATTAGGAGAGGAGAGATGCTGG + Intergenic
904484246 1:30814380-30814402 GAGGAGGGGAGGAGGGCTGTTGG - Intergenic
904497615 1:30895904-30895926 GAGATGGAGAGGAGGGAGGTTGG + Intronic
904877546 1:33668096-33668118 GAGCAGGAGGGGTGAGAGGTGGG + Intronic
904893975 1:33800293-33800315 GAGGAGGAGGGGAGGCCAGTAGG + Intronic
905243570 1:36596903-36596925 GAGTAGGCAGGGAGGGGTGGTGG - Intergenic
905346402 1:37313959-37313981 GAGGAGGAAGGGAGGGAGGGAGG - Intergenic
905553931 1:38866783-38866805 GGACAGGAGGGGAGGGAGGTGGG - Intronic
905912750 1:41664903-41664925 GAGGTGGAGGGGAAGGATGAAGG + Intronic
906187333 1:43871715-43871737 GTGAGGGAGAGGAGGGATGTGGG + Intronic
906197738 1:43939300-43939322 GGGAAGGAGGGGAGGGAGGGAGG + Intergenic
906350952 1:45058807-45058829 AAGTAGGAGGAGAAGGAAGTGGG + Intronic
906794764 1:48688110-48688132 AAGAAGGAAGGGAGGGATGAAGG + Intronic
906835382 1:49078193-49078215 GAGTAGGAGGAGAGAGAAGCAGG + Intronic
906871643 1:49488678-49488700 TAGTGGGAGGGGTGGGATGTGGG - Intronic
907193201 1:52665702-52665724 AAGAAGGATGGGAGGGAGGTGGG - Intronic
908318357 1:62956945-62956967 GAGAAGGGAGGGAGGGATGAAGG - Intergenic
909938527 1:81583163-81583185 GAATAGTAGGGGAAGGAAGTTGG - Intronic
910611181 1:89144015-89144037 GAGGAGGCAGGGAGGGAAGTAGG - Intronic
910979845 1:92949143-92949165 GAGTGGGAGGGTAGAGAAGTGGG - Intronic
911137692 1:94458954-94458976 GTGGAGGAGGGGAGGGAAGCGGG - Intronic
911358090 1:96846003-96846025 GAGGGGGAGGAGAGGGAAGTGGG - Intergenic
912509857 1:110181852-110181874 GAATAGGAGGGGAAGGAGGTAGG + Intronic
912587133 1:110777410-110777432 GAGTAGGAGTGCAGGGATCTTGG + Intergenic
912679897 1:111722344-111722366 CAGGAGGAAGGGAGCGATGTGGG + Exonic
912974979 1:114321332-114321354 GAGTAGGGGTGGGGGAATGTGGG + Intergenic
913430649 1:118787590-118787612 CATTAGGAGGGGAGGGCTTTGGG + Intergenic
913485188 1:119327382-119327404 GAGCAGGAGGGGCGGGGTGCGGG - Intergenic
913998873 1:143675404-143675426 GAGGAGGAGGGCAAGGAAGTCGG + Intergenic
914509507 1:148318472-148318494 GAGGAGGAGGGCAAGGAAGTCGG + Intergenic
914814396 1:151052891-151052913 GAGGAGAAGGGCAGGGAGGTAGG + Exonic
915310199 1:155002627-155002649 GGGAGGGAGGGGAGGGATGGGGG + Exonic
915426763 1:155833745-155833767 GAGGAGGAGGGGAGGAAGGGAGG + Intronic
915835677 1:159173024-159173046 GAGGAGGAGGGCTGGGATGGAGG + Intronic
916100460 1:161389721-161389743 GAGTATGAGGTGAGGTATGCAGG + Intergenic
916104071 1:161418025-161418047 GAGAAGGGAGGGAGGGAGGTAGG + Intergenic
916604661 1:166328821-166328843 AAGAAGAAGGGGAGGGATGCTGG - Intergenic
916853243 1:168725308-168725330 GAGAAGGAAGGGAGGGAGGGAGG - Intronic
917036063 1:170748174-170748196 GAGTAGGAGGGAAGGGAGGGAGG - Intergenic
917101362 1:171449156-171449178 GGGTGGGTGGGGTGGGATGTGGG - Intergenic
917139269 1:171818489-171818511 GAGTGGGAGGAGAGTGAAGTGGG - Intergenic
917598363 1:176552317-176552339 GAGGGGGAGGGGAGAGATGGAGG - Intronic
917600033 1:176564925-176564947 GGAAAGGAGGGGAGGGAAGTGGG - Intronic
917671136 1:177274709-177274731 GAGGAGGAGGGAAGTGATGGGGG + Intronic
918168569 1:181974171-181974193 GAGTAGGTGGGATGGGATGGTGG + Intergenic
918170132 1:181988614-181988636 GCTCAGGAGGGGTGGGATGTGGG - Intergenic
918586354 1:186193244-186193266 GAGGAGGAGGGGAGGGAGAAGGG + Intergenic
918841773 1:189549839-189549861 GGGTAGGAGGGGAGGGGAGAAGG + Intergenic
919005424 1:191892861-191892883 AAGTAGGTGGGGAGTGATCTTGG + Intergenic
919732274 1:200920894-200920916 GAGGAGCAGGGGTGGGGTGTAGG + Intergenic
919739460 1:200973333-200973355 GAGAGGCAGGGGAGGGATGAGGG + Intronic
919814056 1:201426677-201426699 GAGAAGGCGGGGAGGGGTGTGGG - Intronic
919833241 1:201556594-201556616 GGGTTGGAGGGGAGGGAACTGGG + Intergenic
920035250 1:203061090-203061112 GAGGATGAGGGGAAGGCTGTGGG + Intronic
920129422 1:203720294-203720316 GAGTAGGAGGGGAGGGTGAAAGG + Intronic
920161015 1:203997627-203997649 GCGGAGGTGGGGAGGGAAGTTGG - Intergenic
920737579 1:208547051-208547073 GAGGATGAGGGGGGGGATGGAGG + Intergenic
920833491 1:209486462-209486484 GGGGAGGGGGAGAGGGATGTAGG - Intergenic
921222400 1:212982368-212982390 GAGGAGGATGGCAGGGAGGTGGG + Intronic
921253211 1:213316731-213316753 GTGTTGGAGGGGAGGTCTGTGGG + Intergenic
921301698 1:213757066-213757088 GAGAAGGAGGAGAGAGATGGTGG - Intergenic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921850198 1:219926389-219926411 AAGTTGGAAGGGAGAGATGTTGG + Intronic
922213268 1:223501218-223501240 GAGGAGGAGGAGAGGGAGGAGGG - Intergenic
922718366 1:227888220-227888242 GGCTAGGAGGGGATGGATGGTGG + Intergenic
922723213 1:227909606-227909628 GGGAAGGAGGGGAGGGAGGAGGG + Intergenic
923051911 1:230395528-230395550 GAGGAGGAGGGGAGGAGGGTGGG - Intronic
923480958 1:234383029-234383051 GAGAAGGAAGGGAGGGAGGGAGG + Intronic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
923482637 1:234397851-234397873 GAGGGGGAGGAGAGGAATGTGGG + Intronic
923515823 1:234697196-234697218 GAGTTGGTGGGAAAGGATGTAGG + Intergenic
923563404 1:235058936-235058958 GAGAAGGAAGGGAGGGAGGAAGG + Intergenic
924033467 1:239910738-239910760 GAGAGGGAGGGGAGGGAGGTGGG + Exonic
924049300 1:240064158-240064180 AAGTGGGAGGGGAGGGGAGTAGG + Intronic
1062833794 10:623460-623482 GGGGAGGAGGGGAGGGATGCAGG + Intronic
1062833818 10:623527-623549 GGGGAAGAGGGGAGGGATGCAGG + Intronic
1062833829 10:623555-623577 GGGGAGGAGGGGAGGGATGCAGG + Intronic
1062833840 10:623583-623605 GGGGAGGAGGGGAGGGACGCAGG + Intronic
1062833904 10:623753-623775 GGGGAAGAGGGGAGGGATGCAGG + Intronic
1062833914 10:623781-623803 GGGGAGCAGGGGAGGGATGTAGG + Intronic
1062991393 10:1822427-1822449 GTGCAGCAGGGGAGGGACGTGGG + Intergenic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1063510630 10:6642051-6642073 GAATAGAAGGGGAGGCAGGTTGG - Intergenic
1064349759 10:14566264-14566286 CAGTAGGTGGAGAGGAATGTGGG - Intronic
1064505001 10:16019157-16019179 GAGAAGGAGGGGATGGGTGTCGG - Intergenic
1064652105 10:17519664-17519686 AAGGAGGAAGGGAGGGATGGAGG + Intergenic
1064826632 10:19410629-19410651 GGGGAGGAGGGGAGGGAGGGAGG - Intronic
1064881974 10:20065494-20065516 GGGTAGGAGGGGATGGTTTTGGG + Intronic
1064996142 10:21298111-21298133 GAGAAGGAGGGGAGGAAGGAAGG + Intergenic
1065153340 10:22845006-22845028 TATAAGGAGGTGAGGGATGTAGG + Intergenic
1065267442 10:23992439-23992461 GAGTAACAGGAGAGGGATGGAGG + Intronic
1065383845 10:25115154-25115176 GAGAAGGGAGGGAGGGATGGAGG - Intergenic
1065383876 10:25115235-25115257 GAGAAGGGAGGGAGGGATGGAGG - Intergenic
1065383907 10:25115316-25115338 GAGAAGGGAGGGAGGGATGGAGG - Intergenic
1065506911 10:26438532-26438554 GTGTAGTAGGGGTGGGATGGGGG + Intronic
1065765635 10:29026941-29026963 AAGAAGGAAGGGAGGGAGGTAGG + Intergenic
1065901996 10:30216372-30216394 GAGTAGGATGGGAGGGGGGATGG + Intergenic
1066107019 10:32165248-32165270 GAGTGGGAGGAGAGGGAGGCTGG + Intergenic
1066214403 10:33272509-33272531 GAGGAGGAGGGGAGGCAAGGAGG + Intronic
1066440188 10:35431298-35431320 GAGGAGGAGGGGAGGAGTGAAGG - Intronic
1067158094 10:43799634-43799656 GACCAGGAGGGGATGGTTGTGGG + Intergenic
1067337864 10:45379165-45379187 GACTAAGAGGGGAGGGAGATGGG - Intronic
1068268851 10:54693016-54693038 GGGTATGAGGGGAGGGAACTTGG - Intronic
1069923031 10:71828913-71828935 GTAGAGGAGGAGAGGGATGTTGG + Exonic
1070147089 10:73782260-73782282 GGGTAGGAGGGCAGGAAGGTGGG + Intronic
1070341914 10:75505731-75505753 GAGTAGGGGTGGAGGGATCAGGG - Intronic
1071450181 10:85786578-85786600 CAGCAGGGTGGGAGGGATGTCGG - Intronic
1071472442 10:85993210-85993232 GAGGACAAGGGGAGGGATGTGGG + Intronic
1071731585 10:88253790-88253812 CAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1071854369 10:89608366-89608388 AAGAAGGAGGGGAGGGATGGTGG + Intronic
1072079204 10:92012082-92012104 GAGGGGGAGGGGAGGGAGGGAGG - Intronic
1072309619 10:94141696-94141718 GAGAAGGAAGGGAGGGAGGGAGG + Intronic
1072622409 10:97088867-97088889 GAGGATGAGGGGAGGGTTTTGGG - Intronic
1072688075 10:97550526-97550548 GAGCAGGTGGGGAGGGGTGGAGG - Intronic
1072807495 10:98433690-98433712 GAAAAGGAGGGGAGGGTTGAAGG + Intronic
1072926326 10:99620310-99620332 GAGTTGGAGGGGCGGGGTGCTGG - Exonic
1073042153 10:100615115-100615137 GATCAGGAGGTGAGTGATGTGGG - Intergenic
1073065871 10:100758932-100758954 GAGGAGGAGAGGTGGGGTGTGGG + Intronic
1073382873 10:103094098-103094120 GGGTGGGATGGGAGGGTTGTGGG - Intronic
1073444973 10:103575163-103575185 GAGAGGGAGGGGCGGGAAGTGGG - Intronic
1073480334 10:103782658-103782680 GGGGAGAAGGGGAGGGAGGTGGG + Intronic
1073775869 10:106785350-106785372 AAGGAGGAGAGGAGGGATGTAGG - Intronic
1074629829 10:115239940-115239962 GAGTGGGAGTTGAGGGATGAAGG + Intronic
1074827982 10:117228444-117228466 GAGGAGGAAGGGAAGGATGGAGG - Intergenic
1074885440 10:117689327-117689349 GGGAAGAAGGGGAGGGAGGTGGG + Intergenic
1075065570 10:119287039-119287061 GAATAGGAGGGAAGGGAGGGAGG + Intronic
1075081210 10:119385105-119385127 CAGTTGGAGGGGAGGGAGGAGGG + Intronic
1075631394 10:124002690-124002712 GAGTAGCTGGGGAGGAATGAGGG + Intergenic
1075636945 10:124035841-124035863 GAGTAGGAGGTGAGGAGAGTGGG - Intronic
1075753227 10:124791310-124791332 GAGTAGGAGGGGAGGGATGTGGG - Intronic
1076176791 10:128374460-128374482 GAGCAGGAGGGTGGGGATGGAGG - Intergenic
1076211641 10:128651364-128651386 GAAGAGTAGGGGAGGGATGAAGG + Intergenic
1076393397 10:130120641-130120663 GAATAGAAGGGGAGGCAGGTTGG - Intergenic
1076553890 10:131309206-131309228 GAGCAGAAGGGCAGAGATGTGGG + Exonic
1076682515 10:132180476-132180498 GGGTAGGGCGGGAGGGATTTGGG + Intronic
1077009780 11:374831-374853 GAGGAGGAAGGGAGGGAGGGAGG + Intronic
1077009788 11:374850-374872 GAGGAGGAAGGGAGGGAGGGAGG + Intronic
1077009796 11:374869-374891 GAGGAGGAAGGGAGGGAGGGAGG + Intronic
1077009804 11:374888-374910 GAGGAGGAAGGGAGGGAGGGAGG + Intronic
1077009818 11:374922-374944 GAGGAGGAAGGGAGGGAGGGAGG + Intronic
1077009826 11:374941-374963 GAGGAGGAAGGGAGGGAGGGAGG + Intronic
1077009846 11:374990-375012 GAGGAGGAAGGGAGGGAGGGAGG + Intronic
1077009854 11:375009-375031 GAGGAGGAAGGGAGGGAGGGAGG + Intronic
1077023636 11:430479-430501 GGGCAGCAGGGGAGGGATGGGGG + Intronic
1077082061 11:728616-728638 GAGGAAAAGGGGAGGGATGGGGG + Intergenic
1077272198 11:1686671-1686693 GAGAAGGAAGGGAGGGAGGCAGG - Intergenic
1077272289 11:1686946-1686968 GAGAAGGAAGGGAGGGAGGCAGG - Intergenic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077664823 11:4098373-4098395 GAGAGGGAGGGGAGGGAGGGAGG - Intronic
1077693426 11:4370454-4370476 CAGGAGGAAGGGAGGGAGGTGGG - Intergenic
1078735853 11:14020095-14020117 GAGAAGGAGGGAATGGCTGTTGG + Intronic
1078795514 11:14588360-14588382 GAGTAGGTGGAGGGAGATGTAGG + Intronic
1078891614 11:15563042-15563064 GAGAAGCAGGGGAGAGAAGTAGG - Intergenic
1081540371 11:44030395-44030417 GAATAGGCGGGGAGGGATGGAGG - Intergenic
1081619703 11:44611992-44612014 GGGTGGGTGGGGAAGGATGTGGG + Intronic
1082081208 11:48013799-48013821 GGGTAGGGGAGGAGGGATCTGGG - Intronic
1082564965 11:54665942-54665964 GAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1083310394 11:61780841-61780863 GAGAGGGAGGGGAGGGAGGCAGG - Intronic
1083549029 11:63571963-63571985 GAGGAGGAAGGGAGGGAGGGAGG + Intergenic
1083605006 11:63973277-63973299 GGGTAGGAAGGAAGGGAAGTTGG + Intergenic
1083762029 11:64823964-64823986 GAGAAGGAGGGAAAGGATGTAGG - Exonic
1084145953 11:67265543-67265565 GAGTAGGAGGGGTGGGATCAGGG + Intergenic
1084393225 11:68892060-68892082 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393247 11:68892137-68892159 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393258 11:68892177-68892199 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393269 11:68892216-68892238 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393281 11:68892256-68892278 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393293 11:68892296-68892318 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393305 11:68892336-68892358 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393317 11:68892376-68892398 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393329 11:68892416-68892438 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393341 11:68892456-68892478 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393353 11:68892496-68892518 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393365 11:68892536-68892558 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393377 11:68892576-68892598 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393389 11:68892616-68892638 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084393399 11:68892656-68892678 GAGGAGAAGGGGAGCGAGGTGGG + Intronic
1084617252 11:70244794-70244816 GAGGAGGAGGAGAGGGAAGGAGG + Intergenic
1085402949 11:76245468-76245490 GGGTAGGAGGGGAGGGACTTGGG + Intergenic
1085483243 11:76840058-76840080 GAAGAGGAGGGGAGGTTTGTTGG - Intergenic
1086530323 11:87777477-87777499 CAGGAGGAAGGGAGGGATGGGGG - Intergenic
1087194988 11:95296394-95296416 GGGAAGGGGGGCAGGGATGTTGG - Intergenic
1087779918 11:102291018-102291040 CAATAGGAGGGGAGGGAGCTGGG - Intergenic
1087829679 11:102805869-102805891 GGGTAGGATGAGAGGGAAGTGGG - Intergenic
1088653037 11:111975144-111975166 TAGTAGGAGGGTAGGAAGGTAGG + Exonic
1089073012 11:115715950-115715972 GAAGAGGAGGGGTGGGATGGGGG - Intergenic
1089196315 11:116695861-116695883 GAGAAGGAGGGAAGGGAGGAGGG - Intergenic
1089221368 11:116874768-116874790 GAGTAGGAAGAGAAGGTTGTGGG - Intronic
1089401081 11:118165083-118165105 GAGGAGGAGTGGAGGGAAGCAGG - Exonic
1089529447 11:119116841-119116863 GAGCAGGAGGGGAGGCAGGAAGG - Exonic
1090044232 11:123316882-123316904 GAGAGGGAGGGGAGGGAGGGAGG + Intergenic
1090287082 11:125509273-125509295 GAGAGGGAAGTGAGGGATGTAGG + Intergenic
1090427411 11:126618121-126618143 GAGCAGGAGGAGAGGGGAGTGGG - Intronic
1090433089 11:126663136-126663158 GAGAGGCAGGAGAGGGATGTGGG + Intronic
1090813105 11:130265100-130265122 GAGGAGGAGGAGAGAGATGGGGG - Intronic
1090933325 11:131319400-131319422 GAGAAGGAGGGGAGGGGAGGGGG - Intergenic
1091378957 12:43389-43411 AGGTAGCAGGGGAGGGATGAAGG - Intergenic
1091591479 12:1845390-1845412 GGGGAGGAGGGGAGGGAGGAGGG + Intronic
1091662398 12:2394219-2394241 GAGTAGGAGGAGGGCCATGTGGG - Intronic
1091740388 12:2957079-2957101 GAGGAGGAGGGGAAGGAGCTAGG - Intergenic
1092119450 12:6033857-6033879 GAGGAGGAGGGGCGGGAGCTTGG - Intronic
1092660435 12:10732854-10732876 GACGAGGAGGGGATGGATTTGGG + Intergenic
1092905288 12:13095706-13095728 GGGTAGGAGGAGAGGGAGGAGGG - Intronic
1092968855 12:13672332-13672354 GATAAGCAGGGGAGGAATGTGGG - Intronic
1094053261 12:26243386-26243408 GAGTAGGAGGGGAGGTGGCTTGG - Intronic
1094101101 12:26763886-26763908 GAGGAGGAGGGTAGGGAAGATGG - Intronic
1094647746 12:32343304-32343326 GAGGAGGAGGAGAAGGATATAGG - Intronic
1094699632 12:32856412-32856434 GAGTAGGGAGGGAAAGATGTGGG + Intronic
1095209619 12:39477067-39477089 GAGTAGAATGGGAGGCAGGTTGG - Intergenic
1095309056 12:40674471-40674493 GAGGTGGAGGGGAAGAATGTGGG - Intergenic
1095578194 12:43763705-43763727 GAGTATGAGGGGAGGGAAAATGG - Intronic
1095587018 12:43860712-43860734 GAGGAGAAGTGGAGGGAGGTGGG + Intronic
1095866679 12:46979740-46979762 GAGGAGGAAGGGAGGGAGGAAGG + Intergenic
1095935174 12:47672194-47672216 GGGTAGGAGAGCAGAGATGTAGG - Intronic
1095939065 12:47713942-47713964 GAGCAGGAGGGGAGAGTGGTAGG + Intronic
1096224051 12:49853311-49853333 GGGTAGGAGTGGCGGGAGGTGGG + Intergenic
1096463578 12:51836263-51836285 GAGGAGGAGGAGAGGAAGGTAGG + Intergenic
1096593958 12:52682317-52682339 GAGTAGCAGGGGAGCGGTGAGGG - Intergenic
1096678863 12:53241847-53241869 GAGTAGGAGGGGCGGACGGTGGG - Intergenic
1096777748 12:53974307-53974329 GGGGAGGAGGGGAGGGGTGGAGG + Intronic
1096784354 12:54008753-54008775 GAGGAGAGGGGGAGGGATGGGGG - Intronic
1096809703 12:54161524-54161546 GAGTACAAGAGGAGGGGTGTGGG - Intergenic
1096996330 12:55840455-55840477 GAGAAGGAAGGGAGGGAGGGAGG + Intronic
1097092924 12:56521850-56521872 GAGCAGGAGGAGAGAGATGAAGG - Intergenic
1097293453 12:57939894-57939916 GAGTGGGAGGGGAAGGGTGAGGG + Intergenic
1097686240 12:62693739-62693761 GAGTAGTGGGGGTGGGAGGTGGG - Intronic
1097899540 12:64858933-64858955 GAGTTGGAGGAGAGGAATTTAGG + Intronic
1098069288 12:66654673-66654695 AAGGAGGAGAGGAGGGCTGTGGG + Intronic
1098070413 12:66668538-66668560 GAGGAGGAGGGGAAGGAGGAAGG + Intronic
1098587247 12:72168676-72168698 CAGTTGGAGGGAAGAGATGTTGG - Intronic
1098713445 12:73798440-73798462 GAGTAGGAGATGAAGGATGTTGG + Intergenic
1098762918 12:74447377-74447399 GAGGAGGATTGGAGTGATGTTGG - Intergenic
1098905687 12:76159908-76159930 TAGTAGGAGGAGGGGGATGAAGG - Intergenic
1099082927 12:78208943-78208965 AAGTAGGAAGGTAGGGGTGTGGG + Intronic
1099141395 12:78980927-78980949 GAGATGGAGGGGAGAGATGCTGG + Intronic
1099193713 12:79589602-79589624 GAGAAGGAGGGAAGGGCTTTTGG - Exonic
1100137096 12:91566952-91566974 GGGAAGGAGGGAAGGGAGGTGGG - Intergenic
1100420232 12:94425120-94425142 GAGCAGGAGGAGAGAGATGAAGG + Intronic
1100563262 12:95770210-95770232 GAGTAAGAAAGGTGGGATGTAGG + Intronic
1101135868 12:101742523-101742545 AGGAAGGAGGGGAGGGATGCTGG - Intronic
1101473348 12:105020142-105020164 GAGTAGGATATGAGGGATGATGG - Exonic
1101638317 12:106565928-106565950 GAGAAGGAAGGGAGGGAGGAAGG + Intronic
1101833465 12:108277771-108277793 GAGGAGGAAGGGAGGGAGGGAGG - Intergenic
1101975245 12:109352352-109352374 GAGTGGGAGGTGAGAGATGAGGG - Intronic
1102075964 12:110060498-110060520 GGGAAGGAGGTGAGGGAGGTGGG - Intronic
1102177453 12:110886635-110886657 GGGTGGGAGGAGAGGGAGGTTGG - Intronic
1102457891 12:113082205-113082227 GCGTGGGTGGGGAGGGATGAGGG - Intronic
1102517512 12:113459834-113459856 GAAGAGGAGGGGAGGGAGGCAGG - Intergenic
1102582565 12:113899984-113900006 GGGCAGGAGGGGAGGAATGAGGG + Intronic
1102673634 12:114641052-114641074 AAGGAGGAAGGGAGGGATGGAGG - Intergenic
1102851223 12:116246866-116246888 GGAGAGGAGGGGAGGGAGGTGGG + Intronic
1102997487 12:117361349-117361371 GAGGGGGTGGGGAGGGATCTTGG - Intronic
1103454642 12:121055396-121055418 ATGGAGGAGGGGAGGGAGGTGGG - Intergenic
1103466398 12:121145268-121145290 GGGAAGGAGGCGAGGGAAGTGGG + Intronic
1103487567 12:121293702-121293724 GAGTAGGAGGGGAAGGGGATAGG - Intronic
1104081062 12:125430934-125430956 GAGGAGGCAGGGAGAGATGTGGG + Intronic
1104668757 12:130666649-130666671 GGGAGGGAGGGGAGGGATGGAGG + Intronic
1104841003 12:131825655-131825677 GAGAAAGAGGGGAGGGAGGAAGG - Intergenic
1105210663 13:18254957-18254979 GAGGAGGTGGGGAGGGAGGGTGG + Intergenic
1105359272 13:19691976-19691998 GAGCAAGCGGGGAGGGATGGAGG + Intronic
1105592866 13:21810741-21810763 GAGAAAGGGGAGAGGGATGTTGG + Intergenic
1105610070 13:21960899-21960921 GTGTATGTGGTGAGGGATGTAGG - Intergenic
1105868232 13:24480288-24480310 GAGAAGGAGGAGAGAGATGAGGG - Intronic
1105950797 13:25228080-25228102 TAGGAGGAGGGGAAGGCTGTGGG - Intergenic
1105986667 13:25573870-25573892 GAGAAGGAGTGGAGAGTTGTGGG + Intronic
1106061160 13:26293915-26293937 GAGGAGGAGGGGAGTGATTGGGG - Intronic
1106073833 13:26440398-26440420 GAGTGGGTAGGGAGAGATGTAGG + Intergenic
1106752511 13:32789491-32789513 TTGTAGGAGGGCAGAGATGTTGG - Intergenic
1107826456 13:44332820-44332842 GAGTAGGTGGGGAGTGAGATGGG - Intergenic
1108243649 13:48493373-48493395 GAGGAGGGAGGGAGGGAGGTAGG - Intronic
1108694235 13:52888718-52888740 GAGTAGGAGAGGAGACATGCTGG - Intergenic
1109571338 13:64193989-64194011 GAGTAGCATGAGATGGATGTGGG - Intergenic
1110056541 13:70981319-70981341 GGGAGGGAGGGGAGGGATGCAGG - Intergenic
1110211280 13:72976349-72976371 GCGAAGGAGGGGAGGGAAGGAGG + Intronic
1110315459 13:74101239-74101261 GAGGAGAAAGTGAGGGATGTAGG - Intronic
1110912425 13:80981169-80981191 GAGGAGGAAGGGAGGGAGGGAGG + Intergenic
1111048420 13:82846759-82846781 GAGGAGGAAGGGAGGGAGGCAGG + Intergenic
1112108998 13:96273964-96273986 GAGGAGGAGGGGAGGGAGGGAGG - Intronic
1113592801 13:111512745-111512767 GAGGAGGAGGGGTGGGATTCAGG + Intergenic
1113891495 13:113737932-113737954 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1114162994 14:20189884-20189906 GATGAGGAGGGAAGGGATGAAGG + Intergenic
1114454787 14:22847445-22847467 GAGCAAGAGGAGAGGGATGTCGG + Exonic
1114631402 14:24161652-24161674 GAGTAGGTGGGGCAGGAAGTAGG - Intronic
1115428384 14:33287605-33287627 AAGTAGTAGGAGAGGGATGCAGG - Intronic
1116368133 14:44094985-44095007 GAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1117369456 14:55063115-55063137 GAGGAGGAGGAGCGGGATATGGG - Exonic
1117522315 14:56563022-56563044 GAGAAGGAAGGGAAGGATGGAGG + Intronic
1117960486 14:61157036-61157058 GAGTGGGAAGGAAGAGATGTGGG + Intergenic
1117994526 14:61466498-61466520 GACTAGGGGGTGAGGGATGGAGG + Intronic
1118352584 14:64983665-64983687 GAGTAGGAGGGCACAGATGATGG + Intronic
1118610759 14:67537807-67537829 GAGTAGGATGGGTGGGAAGGTGG - Intronic
1118744427 14:68763382-68763404 GAGGAGGTAGGGAGGGATGGTGG + Intergenic
1118782431 14:69017811-69017833 GAGAGGCAGGGGAGGGTTGTGGG - Intergenic
1119102809 14:71895913-71895935 GAGTAGGAGGAGAGTGAGGTTGG - Intergenic
1119262115 14:73244198-73244220 GAGAAGGAGGGGATGAATATTGG + Intronic
1119785513 14:77310705-77310727 GATTAAGTGGGGAGGGATCTTGG - Intronic
1120542355 14:85765908-85765930 GAATTGGTGGGGAGGGATGGGGG + Intergenic
1121077020 14:91077352-91077374 GAGAAGGAAGGGAGGGAGGAAGG + Intronic
1121085859 14:91145623-91145645 GAGGAGGAGGAGGGGGATGGTGG - Intronic
1121099606 14:91241487-91241509 GAAGAGGAGGAGATGGATGTAGG - Intronic
1121371949 14:93367030-93367052 GAGCAGGAGATGAGGGCTGTGGG - Intronic
1121467998 14:94128328-94128350 GGGTAGGAGTGGAGGGGTGATGG - Intronic
1122921167 14:104880874-104880896 GGGTAAGAGGTGAGGGATGTGGG - Intronic
1123767400 15:23495165-23495187 GGGTAGGGTGGGAGGGAGGTGGG + Intergenic
1124957847 15:34371172-34371194 GAGTAGGAGAGGTAGGAAGTGGG - Intergenic
1125695323 15:41632414-41632436 GGGGAGGAGAGGAGGGATGTTGG - Intronic
1125697528 15:41651739-41651761 GAGGAGGAGGGGAAGGAAGAGGG - Intronic
1125741153 15:41965924-41965946 GAGTAGGTGGGGCGGGGGGTGGG - Intronic
1125744774 15:41990717-41990739 GAAGAGGAGGGGAGGGAGGGAGG - Intronic
1125891965 15:43273717-43273739 GAGGAGGAGGGGAGGGGGTTGGG + Intergenic
1126410621 15:48369555-48369577 TGGTAGGAGTGGAGGGTTGTGGG - Intergenic
1126417970 15:48438634-48438656 GAAGAGGAGGGCAGGGCTGTGGG + Intronic
1127394843 15:58536300-58536322 GAGGAGGAGGTGGGGGATGAGGG + Intronic
1127976552 15:64001493-64001515 GAGGAGGATGGGAAGGAAGTGGG + Intronic
1128677991 15:69625843-69625865 AAGAAGGAAGGGAGGGATGGAGG - Intergenic
1128698571 15:69787715-69787737 GAGTAGTGCGGGAAGGATGTTGG + Intergenic
1128704575 15:69829215-69829237 GAGGAGGAGGGGAAGGAGGTGGG - Intergenic
1128704999 15:69832223-69832245 GAATAGGAGGGGAGGGGAGGGGG + Intergenic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129521508 15:76189343-76189365 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1129882571 15:79016922-79016944 CAGCAGAAGGGGAGGGAGGTTGG - Intronic
1129933021 15:79428176-79428198 GAGAGGGAGGGGAGGGAGGGAGG - Intergenic
1130277465 15:82488955-82488977 GAGAAGGAGGTTAGGGATATTGG - Intergenic
1130383826 15:83394241-83394263 GAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1130440584 15:83949143-83949165 GGGTAGTTGGGCAGGGATGTGGG - Intronic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130927144 15:88394186-88394208 GAGGAGGGGAGGAGGGATGTTGG + Intergenic
1130951729 15:88596217-88596239 GAAGAGGAGGGGAGGGAGGGGGG - Intergenic
1131071632 15:89470000-89470022 GGGTGGGAGGGGTGGGAGGTGGG + Intergenic
1131143621 15:89998231-89998253 GAGGAGCAGGGGAGGGATAGGGG - Intergenic
1131234103 15:90681551-90681573 GTCTGGGAGGTGAGGGATGTGGG - Intergenic
1131544892 15:93307825-93307847 GTGTAGGAGAGTCGGGATGTTGG + Intergenic
1132102542 15:99034804-99034826 GAGTAGGAGAAGAGAGAGGTGGG + Intergenic
1132129948 15:99266947-99266969 GAGTATGAGGGTAGGGGTGGAGG + Intronic
1132301932 15:100781407-100781429 GAGGAGGAAAGGAGGGGTGTGGG - Intergenic
1132304345 15:100800706-100800728 GAGAAGAAGTGGAGGGATGTGGG + Intergenic
1132344037 15:101096841-101096863 GGGTAGGAGGAGAGGGAGGATGG + Intergenic
1132918052 16:2364772-2364794 GGGAAGGAGGGGAGGGAGGGAGG + Intergenic
1133567363 16:7008660-7008682 GAGGAGGAAGGGAGGGAGGGAGG - Intronic
1133567395 16:7008735-7008757 GAGGAGGAAGGGAGGGAGGGAGG - Intronic
1133567408 16:7008766-7008788 GAGGAGGAAGGGAGGGAGGGAGG - Intronic
1133978510 16:10617246-10617268 AAGTAGGAGGAGTGGGAGGTAGG - Intergenic
1134261425 16:12654293-12654315 GAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1134449511 16:14354475-14354497 GAGGAGGAGGGGAGGGGAGAGGG + Intergenic
1134449521 16:14354497-14354519 GAGGAGGAGGGGAGGGGAGAGGG + Intergenic
1134449536 16:14354536-14354558 GAGGAGGAGGGGAGGGGAGAGGG + Intergenic
1134569505 16:15279359-15279381 GAGTGGGAGGAAATGGATGTGGG - Intergenic
1134664012 16:16005202-16005224 CAGTAGGATGGGAAGGCTGTGGG + Intronic
1134710883 16:16326505-16326527 AAGGAGGAGGGGAGGGGTGAGGG - Intergenic
1134732872 16:16476690-16476712 GAGTGGGAGGAAATGGATGTGGG + Intergenic
1134934568 16:18235281-18235303 GAGTGGGAGGAAATGGATGTGGG - Intergenic
1134948718 16:18342140-18342162 AAGGAGGAGGGGAGGGGTGAGGG + Intergenic
1135050022 16:19185165-19185187 GGGGAGGAGGGGAGGGAGGAAGG - Intronic
1135210295 16:20520206-20520228 GAGAAGGAAGGGAGGAATGAAGG + Intergenic
1135839200 16:25859023-25859045 GTGTGGGGTGGGAGGGATGTTGG - Intronic
1135874327 16:26183783-26183805 GAGTATAAGGGGAGGGGAGTGGG + Intergenic
1135956366 16:26959725-26959747 GAGAAGGAGAGGAGGGAGATAGG - Intergenic
1135976775 16:27113634-27113656 GAGCAGGAGGAGAGAGAGGTGGG + Intergenic
1136220391 16:28824055-28824077 CAGTAGGAGGGGAGCGAGGTGGG + Intronic
1137442285 16:48507700-48507722 GGGTTGGAGGGGAGGGATGAAGG + Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1137557024 16:49477227-49477249 GAGAAGGAGGGGAAGGAGGAGGG + Intergenic
1137557035 16:49477251-49477273 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557046 16:49477275-49477297 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137737496 16:50735768-50735790 GGGTTGGATGGGAGGGATGAGGG + Intergenic
1137774012 16:51040878-51040900 GAGAAGGAGGGGAGGAAGGAGGG + Intergenic
1137774069 16:51041038-51041060 GGGGAGGAGGGGAGGGAGGAGGG + Intergenic
1137983905 16:53091815-53091837 GAGAAGGAAGGGAGGGAGGGAGG - Intronic
1138458837 16:57136073-57136095 AAGAAGGAAGGGAGGGATGGAGG + Intronic
1139328467 16:66169600-66169622 GAGGAGGAGGAGAGGGAGGAAGG + Intergenic
1140310379 16:73842527-73842549 GAGTCAGAGGGGACAGATGTGGG - Intergenic
1140419289 16:74804937-74804959 GAGAAGGAGGGGAGGGACAGGGG - Intergenic
1140577970 16:76194873-76194895 GAGCAAGAAGGGAGGGATGTAGG + Intergenic
1140874824 16:79141084-79141106 GAGTAGAATGGGAGGCAGGTTGG - Intronic
1141713937 16:85716355-85716377 GAGGAGGAAGGGAGGGAAGGAGG + Intronic
1141775837 16:86122000-86122022 GAGGAGGATGGAAGGGAGGTGGG - Intergenic
1142172503 16:88630311-88630333 AAGTAGGAGAAGAGAGATGTGGG - Intronic
1142251420 16:88993706-88993728 GAGGAGGAAGGGAGGGAGGAGGG - Intergenic
1142267595 16:89071644-89071666 GAGAAGGTCGGGAGGGATGCAGG - Intergenic
1142366051 16:89650342-89650364 CAGAAGGAGAGGAGGGATCTAGG - Intronic
1142553514 17:755961-755983 GAGCAGGAAGGGAGGGAAGAGGG - Intergenic
1142795430 17:2303570-2303592 GAGGAGGAGGAGAGGGAGGCGGG + Intronic
1142953893 17:3506985-3507007 GAGAAGGAAGGGAGGGAGGAAGG + Intronic
1143021260 17:3918144-3918166 GAGAGGGAGGGGAGGGAGGGAGG + Intergenic
1143348387 17:6267347-6267369 GAGGAGTGGGGTAGGGATGTGGG + Intergenic
1143385086 17:6524317-6524339 AAGTAGGAGGAGTGGTATGTGGG + Intronic
1143693975 17:8596640-8596662 GAGTAGGAGGGAGGGGGAGTAGG + Intronic
1143693982 17:8596656-8596678 GAGTAGGAGGGAGGGGGAGTAGG + Intronic
1143693989 17:8596672-8596694 GAGTAGGAGGGAGGGGGAGTAGG + Intronic
1143854285 17:9837232-9837254 GTGGAGGTGGGGAGGGATGATGG - Intronic
1144058659 17:11562195-11562217 GAGTTTGATGGCAGGGATGTTGG - Exonic
1144447828 17:15347429-15347451 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144447851 17:15347514-15347536 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144447863 17:15347557-15347579 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144459836 17:15449496-15449518 GAGTAGGAAGGGAGAAGTGTTGG - Intronic
1144772799 17:17769275-17769297 GAGTAGAAGTGGATGGATGGGGG + Intronic
1145709077 17:26952276-26952298 GAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1145722661 17:27088352-27088374 GAGAAGGAAGAGAGGGAGGTAGG - Intergenic
1145892569 17:28427396-28427418 GAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1145894458 17:28445847-28445869 GAGGAGGAGGGGAAGGAGATAGG - Intergenic
1146053734 17:29570936-29570958 GAGGAGGAGGGGAGGAATAAAGG - Intronic
1146086340 17:29833730-29833752 AAGAAGGAAGGGAGGGAAGTAGG - Intronic
1146332219 17:31937080-31937102 GAGGAGGAGAGGAGGGAAGGAGG - Exonic
1146488437 17:33262424-33262446 GAGGAGGAAGGGAGGGAGGAAGG + Intronic
1146594479 17:34157102-34157124 GAGGAGGAGAGGAGGGACGGAGG - Intronic
1147114660 17:38289932-38289954 GTGTGGGAGGTGGGGGATGTGGG + Intergenic
1147257835 17:39192660-39192682 GAGGAGGACTGCAGGGATGTAGG + Intronic
1147603973 17:41763590-41763612 GAGTTGGAGGGAAGAGATGTGGG - Intronic
1147704244 17:42414972-42414994 CAGTGGGAGGGGAGAGGTGTAGG - Intronic
1148051766 17:44773099-44773121 GAGGAGGAGGGAAGGGAGGGAGG - Intronic
1148077702 17:44948482-44948504 GAGTAGGAAGGGCAGGATATCGG - Intergenic
1148119176 17:45197644-45197666 GAGGAGGAGGAGAGGGAGATGGG + Intergenic
1148414954 17:47499273-47499295 GTGTGGGAGGTGGGGGATGTGGG - Intergenic
1148673838 17:49433359-49433381 GAGAAGGAAGGGAGGGAAGATGG + Intronic
1148721220 17:49754648-49754670 GAGAAGAAGGGGAGGGAAGAGGG + Intronic
1148723079 17:49768777-49768799 GAGTAAGAGGGAAGGGACGCAGG - Intronic
1148754295 17:49964608-49964630 GAGGAGGAGGGGAGAGGTCTTGG - Intergenic
1148782812 17:50130942-50130964 GACTAGGAGGTGAGGGAGGAGGG + Intergenic
1148785798 17:50145680-50145702 GAGGAGGAGGGGAGAGAGGATGG + Intronic
1149484326 17:57030209-57030231 GGGTAGTAGGGGAGTGATGATGG - Intergenic
1149986617 17:61352532-61352554 GAGTAGAAGTGGAGGGAAGGAGG + Intronic
1150652533 17:67019343-67019365 GAGGAGGAGGTGAGGGAGGAAGG - Intronic
1150947615 17:69765406-69765428 GAGAGGGAGGGGAGGGAAGAAGG - Intergenic
1151370048 17:73642145-73642167 CAGCAGGAGGGGTGGGATCTTGG + Intronic
1151391858 17:73792863-73792885 GAGGTGGAGGGGAGGGCTGAGGG - Intergenic
1151624754 17:75270004-75270026 GAGAATGAGGGGAGGGGTGGAGG + Intronic
1151914155 17:77105148-77105170 GAATAGAAGGGGAGGCAGGTTGG + Intronic
1152041403 17:77906215-77906237 GGGTAGGAGGGAAGGCATGTCGG - Intergenic
1152265688 17:79293350-79293372 GAGGGGGAGGGGAGGGAGGCAGG - Intronic
1152286061 17:79413943-79413965 GGGTAGGAGAGGGGGCATGTAGG + Intronic
1152637298 17:81435365-81435387 CAGTAGCAGGGGCAGGATGTGGG + Intronic
1153021644 18:634818-634840 GGGAATGAGGGGAGGGATGGAGG - Intronic
1153574120 18:6503974-6503996 GAGGAGGAAGGGAGGGAGGAGGG + Intergenic
1154199491 18:12289373-12289395 TGGAAGGAGGGGAGGGAAGTGGG + Intergenic
1154519172 18:15208448-15208470 GAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1155063136 18:22246277-22246299 GAGGTGGAGGGCAGGGATGGAGG + Intergenic
1155243423 18:23884887-23884909 GAGGGGGCGGGGAGGGCTGTGGG + Intronic
1156506421 18:37598185-37598207 AAGTATGAGTGGAGGGATGGCGG - Intergenic
1156999713 18:43510050-43510072 GAGAAGGAGGGGATGGGGGTGGG + Intergenic
1157098777 18:44711228-44711250 GAGGAGTAGGGGAGGGAGGGAGG - Intronic
1157280574 18:46344313-46344335 GAGTGGGAGGGAAGGGGTGGAGG + Intronic
1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG + Intergenic
1157588144 18:48818348-48818370 GAGTTGGAGGGAAGGGAGGAGGG + Intronic
1158357645 18:56638622-56638644 GAGGGGGCGGGGAGGGATGGGGG + Exonic
1158516896 18:58138322-58138344 GAGGAGGAGGGGAGGGAAGAAGG - Intronic
1158893166 18:61892238-61892260 GAGGTGGAAGGGAGGGCTGTTGG - Intronic
1159924131 18:74251520-74251542 GAGTAGAATGGGAGGCAGGTTGG + Exonic
1160135290 18:76266316-76266338 GAGAAGGAAGGGAGGGAGGAAGG + Intergenic
1160135301 18:76266355-76266377 GAGAAGAAGGGGAGGGAGGAAGG + Intergenic
1160135310 18:76266387-76266409 GAGAAGGAAGGGAGGGAGGAAGG + Intergenic
1160356048 18:78229436-78229458 GAGGAGGAAGGGAGGGAGGGAGG - Intergenic
1160356056 18:78229455-78229477 GAGGAGGAAGGGAGGGAGGGAGG - Intergenic
1160356064 18:78229474-78229496 GAGGAGGAAGGGAGGGAGGGAGG - Intergenic
1160356072 18:78229493-78229515 GAGGAGGAAGGGAGGGAGGGAGG - Intergenic
1160356147 18:78229695-78229717 GAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1160356154 18:78229714-78229736 GAGGAGGAAGGGAGGGAGGGAGG - Intergenic
1160356162 18:78229733-78229755 GAGGAGGAAGGGAGGGAGGGAGG - Intergenic
1160511279 18:79454869-79454891 GTGAAGGTGGGGAGGGGTGTGGG - Intronic
1160676657 19:394754-394776 GAGAAGGATGGGAAGGATGATGG + Intergenic
1160676682 19:394864-394886 GAGAAGGATGGGAAGGATGATGG + Intergenic
1160710002 19:547094-547116 GAGGGGGATGGGAGGGATGAAGG + Intronic
1160943869 19:1632264-1632286 GAGTTGGGGGCGAGGGGTGTGGG - Intronic
1161483037 19:4520167-4520189 TGGAAGGAGGTGAGGGATGTGGG - Intergenic
1161978114 19:7617294-7617316 GAGAAGGATGGGATGGAGGTGGG - Intronic
1162126604 19:8502703-8502725 GAGGAGGAAGGGAAGGAGGTGGG + Exonic
1162821541 19:13226358-13226380 GAGAAGGAGGGGAGACATATAGG + Intronic
1162861159 19:13506477-13506499 GAGAAGGAGGGGCGGGAGGAGGG + Intronic
1162924331 19:13922531-13922553 GAGGAGGAGCAGAGGGATCTGGG - Intronic
1163076154 19:14893559-14893581 GAGCAAGAGGCGAGGGCTGTCGG + Intergenic
1163238008 19:16040491-16040513 GTGGAGGAGGGGAGGGAGGAAGG + Intergenic
1163504236 19:17695331-17695353 GAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1163627948 19:18401632-18401654 GAGTAAGGAGGAAGGGATGTGGG + Intergenic
1163764654 19:19156061-19156083 GAGTAGAAGGGGAGGGAGGTGGG + Intronic
1163833947 19:19562251-19562273 GTGGAGGAGGGAAGGGATGGAGG + Intronic
1164431491 19:28192997-28193019 GAGTAGAATGGGAGGCAGGTTGG - Intergenic
1164522226 19:28988401-28988423 GAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1164650402 19:29887138-29887160 GGGTGGGAGGGGAGGGGTGGCGG - Intergenic
1164744224 19:30599351-30599373 GAGGAGGAAGGGAGGGAAGGAGG - Intronic
1164830573 19:31317168-31317190 GAGCTGGAGGGGAGGGAGGCTGG - Intronic
1164849726 19:31471700-31471722 GAGGTTGTGGGGAGGGATGTAGG - Intergenic
1164876418 19:31693883-31693905 GAGGAGGAGAGGAGGGATTCAGG - Intergenic
1165167235 19:33865392-33865414 CTGTAAGATGGGAGGGATGTCGG - Intergenic
1165329799 19:35135211-35135233 GAGTAGGATGGGAAGGAGGAGGG + Intronic
1166104184 19:40589472-40589494 GAGGGGGAGGGGTGGGATGGGGG + Intronic
1166177024 19:41081545-41081567 GAGTTGGGGGACAGGGATGTGGG + Intergenic
1166198079 19:41219531-41219553 GGGTAGGAGGTGGGGGATGATGG + Intronic
1166208908 19:41292671-41292693 GAGTGTGAGGTGAGGGGTGTTGG + Intronic
1166337709 19:42118361-42118383 GAGTAGGGGTGGATGGAGGTGGG + Intronic
1166784545 19:45359705-45359727 GAGCAGGAGGGGAGGGGCCTTGG - Intronic
1167083980 19:47296526-47296548 GAGAAGGAAGGGAGGGAGGGAGG - Intronic
1167602011 19:50459842-50459864 GAGGAGGTGAGGAGGGATGAGGG + Intronic
1168425143 19:56234098-56234120 CAGTAGGAGAGGAGGTGTGTGGG + Intronic
925034245 2:673744-673766 GAGGAGGAGGGGGAGGATGGGGG + Intronic
925329384 2:3046764-3046786 GGATAGGATGGGAGGGACGTGGG + Intergenic
925831266 2:7898036-7898058 GAGAAGGAAGGGAGGGAGGGAGG + Intergenic
926921816 2:17946738-17946760 GAGGAGGAAGGGAGGGAGGGAGG - Intronic
927078912 2:19608670-19608692 GAATTGGAGGAGAGGGAAGTAGG - Intergenic
927081328 2:19633749-19633771 CAGGAGGAGGGAAGGGATGCTGG - Intergenic
927279174 2:21288534-21288556 GAGTGGGAGGGGAGGGGAGGGGG + Intergenic
928022545 2:27715837-27715859 GAGGAAGAGGGAAGGGGTGTGGG - Intergenic
929236340 2:39609120-39609142 GGGTAGGAGGGGAGTTAGGTGGG + Intergenic
929450917 2:42036472-42036494 GAGTCAGAAGGGAGGGATATGGG + Intergenic
930523684 2:52498919-52498941 GAGTAGGAAGGAAGGGAGGGAGG + Intergenic
931316613 2:61139051-61139073 GAGAAGGAAGGGAGGGAGGAGGG - Intergenic
931340699 2:61398368-61398390 GAGAAGGAGGAGAGAGATGGGGG + Intronic
932088316 2:68782112-68782134 GAGTAGGAGGATAGGGACATGGG - Intronic
932140574 2:69273686-69273708 GAGGAGGGGTGGAGGGGTGTGGG - Intergenic
932426225 2:71637207-71637229 GACCCAGAGGGGAGGGATGTTGG + Intronic
932460183 2:71876954-71876976 AAGTTGGAGGGGAGGGAGGGAGG + Intergenic
932703862 2:74008751-74008773 GAGTAGGAAGGGAGGGGTGGGGG + Intronic
932863292 2:75316601-75316623 GAGTTGGAGAGGATGTATGTGGG + Intergenic
933944799 2:87276691-87276713 GGGTAGGCAGGGATGGATGTAGG - Intergenic
934784664 2:96996255-96996277 GAGGAGAAGGGAAGGGATGGAGG - Intronic
935315980 2:101834221-101834243 GGGGAGGAAGGGAGGGATGGAGG - Intronic
935371772 2:102355625-102355647 GAAGAGGAGGGGAGGGCTGAGGG - Intronic
935373962 2:102376682-102376704 TGGTGGGAGGGGAGGGATGATGG + Intronic
935646562 2:105340883-105340905 GAGTAGGAGGGTAGGGGTAAAGG + Intronic
935723524 2:106000586-106000608 GAGTGGGACCGGAGGGAGGTAGG - Intergenic
936335411 2:111584888-111584910 GGGTAGGCAGGGATGGATGTAGG + Intergenic
936627185 2:114161017-114161039 GAGAAGGAGGGGAGAGAAGAGGG - Intergenic
937207610 2:120246516-120246538 GAGGAGGAAGGAAAGGATGTTGG - Intronic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
938519170 2:132049077-132049099 GAGAAGGAAGGGAGGGAGGGAGG - Intergenic
938804281 2:134791746-134791768 GAGTAGGATGCCTGGGATGTGGG + Intergenic
938826648 2:135012314-135012336 GGGTGGGAGGGGTGGGAGGTGGG + Intronic
939135370 2:138287291-138287313 GCGAAGGAGGGGAGGAATGAGGG + Intergenic
940322906 2:152396124-152396146 AAGGAGAGGGGGAGGGATGTGGG - Intronic
941155208 2:161969480-161969502 AAGTAGGAAGGAAGGCATGTTGG - Intronic
941439134 2:165511663-165511685 GAGGAGGTGGGAAGGAATGTGGG + Intronic
941696199 2:168553847-168553869 GAGTAGAAGGGGAAGAAGGTGGG + Intronic
941703122 2:168626881-168626903 CTGCAGGAGGGGAGGAATGTTGG - Intronic
942341965 2:174958169-174958191 GAGAAGGAAGGGAGGGAGGGAGG + Intronic
942496061 2:176541110-176541132 GGGGAGGAGGGGAGGGAGGGAGG + Intergenic
942833636 2:180266050-180266072 AAGAAGGAGGGAAGGGATGAAGG + Intergenic
943485555 2:188474589-188474611 GGGTAGGAGAGGAGTGATGCTGG + Intronic
943642598 2:190375788-190375810 GAGAAGGAAGGGTGGAATGTGGG - Intergenic
944212642 2:197222267-197222289 GAGGAGGAGGGTAGGGAAGGAGG + Intronic
945057437 2:205881134-205881156 GAGAAGGAAGGGAGGGAGGGAGG + Intergenic
945502503 2:210593384-210593406 GAGAAGGAGGGGAAGGGTGTTGG + Intronic
945753215 2:213813998-213814020 GGGTAGGAGGAGACGGAGGTAGG + Intronic
946199875 2:218065249-218065271 GAGTAGGAGAGGAGGGGTGGGGG + Intronic
946324923 2:218980422-218980444 GACGAGGAGGGGAGGGTGGTTGG + Intergenic
946685843 2:222268906-222268928 GAGTAGGAGGGGGTGGAAGAGGG - Intronic
947007630 2:225530283-225530305 AAGCAGGAAGGGAGGGATGCAGG - Intronic
947511033 2:230754457-230754479 GAGTAGGAGGGGAAGAAGGAGGG - Intronic
947893152 2:233644012-233644034 GATTAGGGGAGGAGTGATGTCGG + Intronic
948207509 2:236170004-236170026 GAGGAGGAGGAGAGGGCTGGCGG - Intergenic
948483857 2:238267706-238267728 GATGAGGATGGGAAGGATGTAGG + Intronic
948505027 2:238422668-238422690 CTGGAGGAGGGGAGGGAGGTTGG + Intergenic
948540685 2:238689830-238689852 GTGTAGGAAGGGAGGGAGGAGGG + Intergenic
948768181 2:240233898-240233920 GAGTTGGAGGGGGGGACTGTGGG - Intergenic
948813741 2:240499358-240499380 GAGTAGGTGGGTGGGGATGTGGG + Intronic
948856235 2:240731914-240731936 GAGGAGGGGAGGAGGGATGAGGG + Intronic
948939254 2:241187934-241187956 GAGAAGGAGGAGAGGGAAGGTGG + Intergenic
1168916073 20:1489540-1489562 GAGAGGGAGGGAAGGGGTGTGGG - Intronic
1169318495 20:4612090-4612112 GAGCAGGAGGAGAGTGATGCTGG + Intergenic
1170874716 20:20239912-20239934 TTATAGGAGGGGAGGGTTGTGGG + Intronic
1170880981 20:20296277-20296299 GGGAAGGAGGGAAGGGATGAGGG - Intronic
1170917375 20:20640454-20640476 GAATAGGAGGGGACAGATGTTGG - Intronic
1171227390 20:23452923-23452945 GAGGAGGAGAGGAGAGCTGTGGG - Intergenic
1171785862 20:29464127-29464149 GAGAAGGAAGGGAGGAATGAAGG - Intergenic
1171862402 20:30412933-30412955 AAGTAGGGAGGGAGGGAGGTAGG + Intergenic
1172273947 20:33669780-33669802 GAGTTGGTGGGGTGGGATGTGGG - Intronic
1172317096 20:33964309-33964331 AAGGAGGAGGGGAGGACTGTGGG + Intergenic
1172777111 20:37414274-37414296 GGGTAGTAGGGGAGGGAGGTAGG - Intergenic
1172937394 20:38630028-38630050 GAGGAGGAGGGAAGGGAGGGAGG - Intronic
1172993006 20:39049877-39049899 GAGTAGGGTAGGAGGAATGTTGG + Intergenic
1173162708 20:40664284-40664306 GAGGAGGAGGGAGGGGATGGAGG - Intergenic
1173197252 20:40925813-40925835 AAGAAGGAAGGGAGGGATGGAGG + Intergenic
1173275171 20:41574123-41574145 GAGGAAGAGGGAAGGGAAGTGGG + Intronic
1173317880 20:41961356-41961378 GAGAAGGGGAGGAGTGATGTAGG + Intergenic
1173716514 20:45211573-45211595 GAGTGGGAGGGAAGGGAGGAGGG + Intergenic
1173794050 20:45846528-45846550 GAGTATGACGGGATGGATGTGGG - Intronic
1173814629 20:45977833-45977855 GAGAAGGGGGGAAGGGATTTTGG + Intergenic
1174123331 20:48283762-48283784 GTGGAGAAAGGGAGGGATGTGGG - Intergenic
1174164578 20:48575708-48575730 GGGGAGGAGGGGAGGGAGGGAGG + Intergenic
1174216681 20:48921557-48921579 GAGAAGGTGGGGAGGGGAGTGGG - Intergenic
1174238656 20:49115202-49115224 GAATAGGAGGGATGGGATGGGGG + Intronic
1174359343 20:50018082-50018104 GAGTAGGAATGGAGGGAGGGAGG - Intergenic
1174960522 20:55151769-55151791 GAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1175121842 20:56721901-56721923 GGGTAGGACGGGAGGGAAGGCGG - Intergenic
1175224878 20:57439225-57439247 GGGTAGGAGGGTGGGGGTGTGGG - Intergenic
1175243607 20:57567837-57567859 GTGCAGGAGGGGAGGGAATTTGG - Exonic
1175392478 20:58636000-58636022 GAGAGGGAGGGGAGGGAGGAAGG + Intergenic
1175773932 20:61641360-61641382 GAGCTGGAGGGGTGGGCTGTGGG - Intronic
1175895137 20:62332764-62332786 GAGTGGGAGGGGAGGGAGGTGGG - Intronic
1176072492 20:63234470-63234492 GCATAGGAGGGGAGGGCTGTCGG - Intergenic
1176222606 20:63977182-63977204 GAGAAGGAGGGCAGGGACGGAGG + Intronic
1176388226 21:6150363-6150385 GAGGAGGAAGGGAGGGAGGGAGG + Intergenic
1177758317 21:25373721-25373743 GAGGAGGAGGGGAGGGGAGGGGG - Intergenic
1178602251 21:34004809-34004831 CAGTGGGAGGGGAGGTATGGGGG - Intergenic
1179037670 21:37773493-37773515 GAGGTGAAGGGGAGGGATGAAGG - Intronic
1179519287 21:41931839-41931861 GAGGTGGAGTGGTGGGATGTTGG - Intronic
1179714693 21:43280782-43280804 GAGGTGGAGGGGAGGGAAGGTGG + Intergenic
1179735246 21:43387885-43387907 GAGGAGGAAGGGAGGGAGGGAGG - Intergenic
1180645705 22:17337146-17337168 AAGAAGGAGAGGATGGATGTTGG - Intergenic
1180780725 22:18517934-18517956 GAGGAGGTGGGGAGGGAGGGTGG + Intronic
1180819445 22:18815737-18815759 GTGTAGGAGGGGGAGGCTGTGGG - Intergenic
1180938557 22:19641897-19641919 GAGAAGGAGAGGAGGGAGGAGGG + Intergenic
1181083382 22:20428223-20428245 GAGAAGGAAGGGAGGGAGGGAGG - Intronic
1181172542 22:21017895-21017917 GTTTATGAGGGAAGGGATGTTGG - Intronic
1181176812 22:21042486-21042508 GTTTATGAGGGAAGGGATGTTGG + Intergenic
1181199620 22:21209571-21209593 GAGGAGGTGGGGAGGGAGGGTGG + Intronic
1181205670 22:21250182-21250204 GTGTAGGAGGGGGAGGCTGTGGG - Intergenic
1181269970 22:21653077-21653099 GAGTGGGAGGTGAGGGTTATAGG - Intronic
1181400140 22:22646287-22646309 GAGGAGGTGGGGAGGGAGGGTGG - Intronic
1181583555 22:23841076-23841098 GACAAGGAGGGGTGGGATATGGG + Intergenic
1181649224 22:24249503-24249525 GAGGAGGTGGGGAGGGAGGGTGG + Intergenic
1181658269 22:24319090-24319112 GAGCAGCAGAGGAGGAATGTGGG - Intronic
1181702112 22:24627385-24627407 GAGGAGGTGGGGAGGGAGGGTGG - Intronic
1181760307 22:25053707-25053729 AAGTAGGAGGGGAGACATTTGGG + Intronic
1181885306 22:26017367-26017389 AAGGAGGAGGGGAGGGAGGAAGG - Intronic
1182051470 22:27315850-27315872 GAGGAGGAGAGGAGGCAGGTGGG - Intergenic
1182355884 22:29722065-29722087 CAGGAGGAGGGGATGGATGAGGG - Intronic
1182923046 22:34097710-34097732 GTGGAGGTGGGGAGGGATGTGGG + Intergenic
1182934386 22:34207466-34207488 GAGTAGGAGGGAAGGGGGCTTGG - Intergenic
1183115633 22:35690547-35690569 GAGGAGAAGGGGAGGGAAGAGGG + Intergenic
1183223928 22:36536359-36536381 GAGGAGGAGGGGAGGGTTGAAGG + Intergenic
1183481356 22:38067216-38067238 GAGTAGGAAGGGAGGGGCCTGGG + Intronic
1183551027 22:38485531-38485553 GAGTTGGTGGGGAGGGAGGGAGG - Exonic
1183661422 22:39223841-39223863 CAGTAGGTGGGAAGGGAGGTGGG + Exonic
1183692449 22:39398383-39398405 GAGTTGGAGGAGAGAGATGAAGG - Intergenic
1183799610 22:40150930-40150952 GTGTAGGAGGGGAGGGGTAAGGG - Intronic
1183969738 22:41468082-41468104 GAGTGGGAAGGGTGGGTTGTTGG + Intronic
1184293421 22:43509769-43509791 GAGGAGGAAGGGATGGATGGTGG - Intergenic
1184398331 22:44258880-44258902 GAGTAGGCGTGGAGGGTTGGGGG + Intronic
1184470257 22:44692148-44692170 GAGGAGGAGGAGACGGGTGTGGG - Intronic
1184628028 22:45753170-45753192 GAGGAGGAGGGGAGGGGTTAAGG - Intronic
1184630604 22:45775174-45775196 GAGAAGGAGGGGATGGCAGTGGG + Intronic
1184654495 22:45934292-45934314 CAGGAGGAGAGGGGGGATGTGGG + Intronic
1184686468 22:46098598-46098620 GAGCCAGAAGGGAGGGATGTGGG - Intronic
1184748400 22:46469977-46469999 GAGGAGGAGGGGAGGGAGGGAGG + Intronic
1184762256 22:46551312-46551334 GTGGAGGAGGGGAGGGATCTGGG - Intergenic
1185117903 22:48948610-48948632 GAGGAGGAGGGGAGAGCTGCTGG + Intergenic
1185148000 22:49149741-49149763 GAGAAGCAGGGGAGGGAGGAAGG + Intergenic
1203221253 22_KI270731v1_random:45231-45253 GTGTAGGAGGGGGAGGCTGTGGG + Intergenic
1203269573 22_KI270734v1_random:41590-41612 GTGTAGGAGGGGGAGGCTGTGGG - Intergenic
949149064 3:742435-742457 GTGTTGGAGGGGAGGGATGGTGG + Intergenic
949977295 3:9472723-9472745 GAGATGGAGGAGAGGGAGGTGGG - Intronic
950119395 3:10471559-10471581 GAGTGGGAGGAGAGGGAGGGAGG + Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950360802 3:12448270-12448292 GAGAAGGAAGGGAGGGAGGGAGG + Intergenic
950440890 3:13009585-13009607 CAGGAGGAGGTGAGGGATGAGGG - Intronic
950553732 3:13682722-13682744 GAGTAGGAGAGGAGGGCCCTGGG + Intergenic
950655507 3:14433882-14433904 GAGTAGAAGGGAAGGGTTGGTGG + Intronic
951021639 3:17787297-17787319 GAGGAGGAAGAGAGGGAAGTGGG - Intronic
952043243 3:29285260-29285282 GAGTAGGTGGGGGTGGATGGGGG + Intronic
952231123 3:31432150-31432172 GAGTGGGAGGGGAGTGCAGTGGG - Intergenic
952590108 3:34942487-34942509 AAGTAGGAAGGGAGGGAAGGAGG - Intergenic
954077857 3:48194442-48194464 GAAAAGGAGGGGAGGAATGATGG - Intergenic
954108681 3:48422508-48422530 GTGGAGGAGGGGAGGGCTTTGGG - Intronic
954410355 3:50367906-50367928 GAACAGGAGGGGAGGGGTGGGGG + Exonic
954662685 3:52234510-52234532 GAGTAGGATGGGAGGGTTCTAGG - Intronic
954916147 3:54149973-54149995 GAGGGGGAGGGGAGGGAAGAAGG - Intronic
955942263 3:64157751-64157773 GAGTGGCTGGGGAGGGAGGTGGG + Intronic
956402177 3:68891716-68891738 GAGTGGAAGGGTAGGGATGGGGG + Intronic
960154951 3:114290393-114290415 GAGAAGGAGGGAAGCAATGTGGG + Intronic
960422468 3:117463919-117463941 GGGTAGGAGGGGAGGTGGGTGGG + Intergenic
961510914 3:127402913-127402935 GGGTGGGAGGGGGGCGATGTGGG + Intergenic
961604425 3:128083153-128083175 GAGTTGGAGGGGAGGCAGGCTGG + Intronic
961681916 3:128605042-128605064 GAGGAGCAGGGGTGGGAAGTGGG - Intergenic
962498405 3:135965681-135965703 GAGGAGGAGGAGAAGGAGGTAGG + Exonic
962518995 3:136180735-136180757 GAGGAGGAGAGGAGGGAAGGAGG + Intronic
962668227 3:137678266-137678288 GAGAAGGAAGGGAGGGAGGAAGG + Intergenic
962829620 3:139128576-139128598 GAGGAGGAGGGGAAGGAGGGTGG + Intronic
963652926 3:148006928-148006950 GAGGAGGAGGAGAGGGAGGGAGG - Intergenic
964496221 3:157293176-157293198 GAGTGGGTGGAGAGGGAGGTAGG + Intronic
964562937 3:158018542-158018564 CAGCAATAGGGGAGGGATGTGGG - Intergenic
964860850 3:161199332-161199354 GAGTAGAATGGGAGGCAGGTTGG - Intronic
965373931 3:167897707-167897729 GAGAGGGAGGGGAGGGAGGCAGG + Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965585495 3:170314308-170314330 GAGCAGGATGGGAGGGAGGCTGG - Intergenic
965768746 3:172158855-172158877 GAGGAAGAGGGGAGGGAAGGAGG - Intronic
965951667 3:174316338-174316360 GATGAGAAGGGGTGGGATGTAGG - Intergenic
966248066 3:177830972-177830994 GAGTTTGAGGTGAGGGATGGCGG + Intergenic
966734804 3:183179971-183179993 GAGGAGGGGGAGAGGGATGGAGG + Intronic
966908573 3:184544755-184544777 GAGGAGGAGGAGAGGGAGGAGGG - Intronic
966932992 3:184687669-184687691 GGGGAGGAGGGGAGGGAGGAAGG + Intergenic
967000605 3:185330559-185330581 GAGAAGGAGTGGAGGGCTGGGGG + Intronic
967899982 3:194440058-194440080 GGGTAGGGAGGGAGGGAGGTGGG + Intronic
968628528 4:1638574-1638596 GGGTAGGAGGTGAGAGAGGTGGG + Intronic
968652974 4:1767358-1767380 GGGCAGGAGGGGAGGGAGGGAGG - Intergenic
968782847 4:2596291-2596313 GAGAAGGAGGAGAGGCATGGCGG + Intronic
968889196 4:3358969-3358991 GTGTAGGAGGAGAGGGAGGAGGG - Intronic
968952042 4:3700300-3700322 GAGGAGGAGGGGGAGGAAGTGGG + Intergenic
968982278 4:3856773-3856795 GAGGAGGAGCTGAGGCATGTCGG - Intergenic
969142885 4:5095112-5095134 GACTGGGAGGAGAGGGCTGTAGG + Intronic
969369225 4:6720637-6720659 GGGTAGGAGGGGAGGAAATTAGG + Intergenic
969692171 4:8709788-8709810 GTGTGGAAGGGGAGGGCTGTGGG - Intergenic
970199018 4:13583096-13583118 GTGATGGAGGGGAGAGATGTGGG + Intronic
970383719 4:15535346-15535368 AAGAAGGAGGGGAGGGATGGAGG - Intronic
971050176 4:22853054-22853076 GAATAGAATGGGAGGCATGTTGG - Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
971327914 4:25658923-25658945 GAGCAGGAGGGGAGGGTGGTGGG - Intronic
971515761 4:27484225-27484247 GAGTAGAAAGGGATGGTTGTGGG + Intergenic
971865166 4:32160501-32160523 AAGGAGGAAGGAAGGGATGTAGG - Intergenic
972016102 4:34248358-34248380 GAGTAGGAAGGGAAGGAGGAGGG - Intergenic
972713300 4:41620440-41620462 GAGGAAGAGGGGAGTGAAGTGGG + Intronic
973594333 4:52470588-52470610 GAGCAGGAGGGGTGGGCGGTGGG + Intergenic
973854439 4:54996718-54996740 GAGTAGGAGGGAAGAGAGATAGG + Intergenic
974629134 4:64460572-64460594 CTGTAGGAGGGGAGGGGTGGGGG - Intergenic
975494277 4:75020689-75020711 GAGAGCGAGGGGAGGGTTGTGGG - Intronic
975541936 4:75522571-75522593 TAGTAGGATGGGGGGGAGGTGGG - Intronic
976021209 4:80629315-80629337 GAGTCAGGGGGGAGAGATGTTGG + Intronic
976546786 4:86344654-86344676 GAATATGAGGGGAGGGAGGAAGG + Intronic
977425050 4:96858083-96858105 GAGTAGGATGTGAGATATGTTGG + Intergenic
978209104 4:106113812-106113834 GAGTAGCAGGTGAGGGTTGCAGG - Intronic
978243829 4:106548888-106548910 GAGGGGGAGGGGAGGGGTGGAGG - Intergenic
978811544 4:112854866-112854888 GAGTAGAATGGGAGGGAGGGTGG + Intronic
980183343 4:129429897-129429919 GCGTAGTAGGGGAGTGATGATGG + Intergenic
981533198 4:145773023-145773045 GAGCAGGATGGGAGGGAGGAAGG + Intronic
982882038 4:160731778-160731800 GGGAAGGAAGGGAGGGATGGAGG - Intergenic
983273659 4:165592084-165592106 GAGAAGGAATGGAGGGATGGAGG - Intergenic
983350727 4:166584765-166584787 GAGGAGGAAGGGAGAGATGGAGG + Intergenic
983758611 4:171375732-171375754 GATTAGGTGGGCATGGATGTGGG + Intergenic
983939560 4:173525602-173525624 GAGGAGGCTGGGAGGGATTTTGG - Intronic
984703167 4:182831874-182831896 GAGAAGGAGGGGAGGGGAGAAGG - Intergenic
984703333 4:182832359-182832381 GAGAAGGAGGGGAGGGGAGAAGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985542134 5:492168-492190 GTGGGGGAGGGGAGGGATGTCGG + Intronic
985767581 5:1787922-1787944 GAGCAGGAGGGGAGGGAGGAGGG - Intergenic
986530101 5:8726991-8727013 GAGAGGGAGGGGAGGGAGGGAGG + Intergenic
986583925 5:9294857-9294879 GAGAAGGAGGGGAGGGATGAAGG - Intronic
987103682 5:14616239-14616261 GAGCAGGAGGGCAGTGATTTTGG + Intergenic
987207810 5:15645285-15645307 GAGTAGAATGGGAGGCAGGTTGG - Intronic
987460145 5:18198920-18198942 GAATAGAAGGGGAGGCAGGTTGG - Intergenic
987719605 5:21616886-21616908 GAGTAGGATGGGACGGAGGCAGG + Intergenic
988779018 5:34502480-34502502 GAGAAGGAGGGGAGTGAGGATGG - Intergenic
989241221 5:39204778-39204800 GGGTAGGAGGCTAGGGATTTAGG + Intronic
989979282 5:50623614-50623636 GAGTAATTTGGGAGGGATGTGGG - Intergenic
989983160 5:50666894-50666916 GAGGAGGAGGAGGGGGAGGTCGG - Intronic
990730698 5:58805851-58805873 GTATAGGAGGGAAGGGGTGTGGG + Intronic
990953832 5:61324209-61324231 GAAGGGGAGGGGAGGGAAGTGGG + Intergenic
991975163 5:72177957-72177979 GAGAAGGAGGGAAGGGAGGAAGG - Intronic
992776012 5:80089993-80090015 GAGAAGGAAGGGAGGCCTGTGGG - Intergenic
993310769 5:86329517-86329539 CAGTAGGAGGGGAGGGAGCCAGG - Intergenic
997197556 5:131990023-131990045 GGGCAGGTAGGGAGGGATGTGGG - Intronic
997395174 5:133553966-133553988 GAGTAGCAGAGGAGGGATTTGGG - Intronic
997448309 5:133959829-133959851 GAGGAGTAGGCGAGGGATGAGGG + Exonic
998028018 5:138837507-138837529 GAGAGGGAGGGGAGGGAGGAGGG - Intronic
998183423 5:139961351-139961373 GAGGAGGGGGGCAGGGATGGGGG - Intronic
999174574 5:149623017-149623039 GTGCTGGAGGGGAGGGCTGTGGG - Intronic
999182019 5:149676417-149676439 GAGTAGGCGGGGATGGAACTTGG + Intergenic
999275163 5:150325370-150325392 GAGGAGGAGAACAGGGATGTAGG + Intronic
999361897 5:150992552-150992574 GAGGAGGAGGGGATGGTGGTGGG + Intergenic
999515705 5:152299577-152299599 GAGTCAGAGGGGAGCTATGTAGG - Intergenic
1000770316 5:165344815-165344837 GAGAAGGAAGGGGGGGATGGAGG + Intergenic
1001017247 5:168152753-168152775 GAGTAGAAGAGAAGGCATGTTGG - Intronic
1001084188 5:168688413-168688435 GAGAGGGAGGAGAGGGATGAGGG - Intronic
1001121657 5:168985817-168985839 GAGAAGGAAAGGAGGGATGATGG + Intronic
1001157648 5:169287120-169287142 AATTAGAAGGGGAGGGGTGTTGG + Intronic
1001437903 5:171714917-171714939 GAGGAAAAGGGGAGGGATGCTGG - Intergenic
1001678233 5:173536217-173536239 GAAGAGGAGGAGAGGAATGTGGG - Intergenic
1001791048 5:174458468-174458490 AAGGAGGTGGGGAAGGATGTGGG - Intergenic
1001949716 5:175807803-175807825 AAGGAAGAGGGGAGGGAAGTGGG + Intronic
1002105233 5:176876708-176876730 GAGCAGGACGGGAGGGCAGTGGG + Intronic
1002195449 5:177498491-177498513 TAGTAGCTGGAGAGGGATGTGGG - Intergenic
1002899548 6:1399463-1399485 GAGGAGGAGGAGAGGGAAGCAGG + Intergenic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1004204206 6:13575789-13575811 GATGTGGAAGGGAGGGATGTTGG - Intronic
1004250784 6:14021726-14021748 GAGGGGGAGGGGAGGGAAGAAGG - Intergenic
1004899998 6:20184758-20184780 GAGCAGGAGGGTAAGGATGAGGG - Intronic
1005140957 6:22631060-22631082 GGGTAGGGGGGTAGGGAGGTAGG - Intergenic
1005363010 6:25050008-25050030 GAGCAGGGAGGGAGGGATGAGGG + Intergenic
1005631058 6:27708423-27708445 AAGTAGGGAGGGAGGGAGGTAGG - Intergenic
1006050137 6:31335920-31335942 GAGTGGGAGGTGGGGGATGTTGG + Intronic
1006173677 6:32109437-32109459 GAAGAGGAGGGGTGGCATGTGGG - Intronic
1006298623 6:33181298-33181320 GAGTTTTAGGGGAGGGCTGTGGG - Intronic
1006330380 6:33386147-33386169 AAATAGGAGGGGAGGCAAGTTGG - Intergenic
1006357115 6:33566463-33566485 GAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1006367657 6:33624946-33624968 GGGAAGGATGGGAGGGATCTGGG + Intronic
1006590787 6:35155213-35155235 GAGTTGGAGAGGAGGGAAATGGG - Intergenic
1007550871 6:42728532-42728554 GAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1007657741 6:43462138-43462160 GAGGAGGAGGGGGTGGAGGTTGG - Intergenic
1007687255 6:43674213-43674235 GGGTAGGGGGTGTGGGATGTGGG - Intronic
1007998884 6:46338018-46338040 GATTAGGAGTAGAGGGATGCTGG + Intronic
1008273367 6:49515919-49515941 GAGAGGGAGGGGAGGGAGGGAGG - Intronic
1008484569 6:52021763-52021785 GAGAAGGAGGGGAAGGAGGAGGG - Intronic
1009245382 6:61231208-61231230 GACTGGGGCGGGAGGGATGTGGG + Intergenic
1009395005 6:63189578-63189600 GATAATGAGAGGAGGGATGTAGG - Intergenic
1009828222 6:68896119-68896141 GAGTAGGAGGATAGGAATTTAGG + Intronic
1010053172 6:71532161-71532183 GCGTGGGAGGGGAGGGTTGCTGG + Intergenic
1010298657 6:74232087-74232109 GAGGAGGAAGGGAGGGAGGAAGG - Intergenic
1010331635 6:74629971-74629993 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1010754909 6:79655944-79655966 GAGTGGGAGGGGAAGGTAGTTGG + Intronic
1011248794 6:85348620-85348642 GAAGAAGAGGGGAGGGAGGTTGG - Intergenic
1011543740 6:88462471-88462493 TACTAGGAGGGGAGGGAGGGAGG + Intergenic
1011742611 6:90377637-90377659 GAGGAGGAGGGGAGGGAGGGAGG - Intergenic
1012049534 6:94323750-94323772 GAGTGAGAGGGGATGGTTGTGGG + Intergenic
1012715153 6:102659707-102659729 GACTAGGAGGGGAGGGTGGAGGG + Intergenic
1012902037 6:105017738-105017760 GAGAAGGAGGGGAGGGAGAGGGG + Intronic
1012939544 6:105402725-105402747 GAGGGGGAGGGGAGGGACGCGGG + Intronic
1013060804 6:106631944-106631966 TAGTAGTAGGGGTGGGAAGTGGG - Intronic
1013091955 6:106908244-106908266 GGGTAGGGGGTGGGGGATGTTGG - Intergenic
1013526887 6:110982325-110982347 CCGTGGGATGGGAGGGATGTGGG + Intronic
1014777614 6:125528843-125528865 GGGAAGGAGGGGAGGGAGGAGGG - Intergenic
1014810820 6:125883668-125883690 GAGAAGGATGGGGGAGATGTTGG - Intronic
1014913309 6:127118609-127118631 GAGGAGGAGGGCAGGGAGGGGGG - Exonic
1015263769 6:131268050-131268072 TAGAAGGAAGGGAGGGATGGAGG + Intronic
1016739607 6:147513384-147513406 GGGTGGGAGGGGAGAGAGGTTGG + Intronic
1017081490 6:150673651-150673673 GAGAGGGAGGGGAGGGAAGAGGG - Intronic
1017637336 6:156456149-156456171 GGGGAGGAGGGGAGGGAGGGGGG - Intergenic
1017743865 6:157429601-157429623 GAGAAGGAGGGGAAGGAAGGAGG + Intronic
1017788309 6:157774267-157774289 GGGTAGTGGAGGAGGGATGTGGG + Intronic
1017796835 6:157852418-157852440 GAGGAGGAAGGGAGGGAGGGAGG - Intronic
1017912930 6:158810331-158810353 GGGTAAGTGTGGAGGGATGTGGG - Intronic
1018027234 6:159816117-159816139 GGGTGGGTGGGGAGGGGTGTGGG - Intronic
1018027257 6:159816160-159816182 GGGGGGGAGGGGAGGGGTGTGGG - Intronic
1018250665 6:161866786-161866808 GAGTAGGTGTGGGAGGATGTGGG + Intronic
1018930753 6:168238877-168238899 CAGTAGGTGGAGAGGGTTGTGGG - Intergenic
1019310880 7:360016-360038 CGGGAGGAAGGGAGGGATGTGGG + Intergenic
1019501543 7:1367235-1367257 GGGAAGGAGGGCTGGGATGTGGG - Intergenic
1020222564 7:6251370-6251392 GAGAAGGAGGGGAGACATGTAGG + Intronic
1020240395 7:6390007-6390029 GAGTAGGAGAGGAGGGAAGGAGG - Intronic
1020262286 7:6537030-6537052 AAGAGGGAGGGGAGGGATGGAGG + Intronic
1020731134 7:11882430-11882452 AAGGAGAAGGGGAGGGATGGAGG - Intergenic
1021123113 7:16819357-16819379 GAGGAGGAGGGTAGGGAAATAGG - Intronic
1021510633 7:21428508-21428530 GAGAAGGAGGGAAGGGAGGAGGG - Intronic
1022164822 7:27747934-27747956 GATTAGAAGGGCAGGAATGTAGG + Intronic
1022213383 7:28233958-28233980 GAGAAGGAGGGAAGGAATGGAGG - Intergenic
1022485275 7:30772970-30772992 GGGGTGGTGGGGAGGGATGTGGG - Intronic
1022804389 7:33807346-33807368 CAGTAGGCTGGGAGGGATGAGGG - Intergenic
1023594420 7:41813863-41813885 GTCAAGGAGGGGAGGGATATGGG + Intergenic
1024307575 7:47941144-47941166 AGGTAGGAGGGGAAGGAAGTGGG + Intronic
1024326702 7:48114679-48114701 GAGAAGGAGGGCAGGGATGCAGG - Intergenic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1025790300 7:64681929-64681951 GAGGTTGAGAGGAGGGATGTAGG - Intronic
1025837899 7:65112896-65112918 GAGAAGGAAGGGAGGGAAGGAGG + Intergenic
1025879370 7:65520187-65520209 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1025885169 7:65583088-65583110 GAGAAGGAAGGGAGGGAAGGAGG - Intergenic
1026053467 7:66965805-66965827 GAGTAGTAGGGGATGGTTTTGGG + Intergenic
1026142532 7:67718487-67718509 GAGTAGAATGGGAGGCAGGTTGG - Intergenic
1026166576 7:67915549-67915571 GATTTGCAGGGGAAGGATGTAGG - Intergenic
1026662069 7:72311048-72311070 GAGGAGGTGGGAAGGGATGCAGG - Intronic
1026670070 7:72382605-72382627 GAGGAGAAAGGGAGGGAGGTGGG - Intronic
1026767068 7:73166830-73166852 GAGGAGGAGGAGAGGGAGGGGGG - Intergenic
1026824490 7:73572973-73572995 GAGCGGGAAGGGAGTGATGTGGG + Intronic
1026927397 7:74204048-74204070 GGGAAGGAGGGGAGGGAAGGAGG + Intronic
1027539908 7:79453678-79453700 GGGAAGGAGGGTAGGGATGCCGG + Intergenic
1027889398 7:83951195-83951217 CAGTAGGAGGTGAGTGATGGAGG - Intergenic
1028058473 7:86278454-86278476 GAGTAGGAGGGGAGGTCTATAGG + Intergenic
1028243784 7:88451930-88451952 GGGTATGAGGGGAGGGAGGGAGG - Intergenic
1028480125 7:91295121-91295143 GAGAGGGTGGGGAGGGAGGTGGG + Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1029351597 7:100016646-100016668 GAAAGGGAGGGGAGGGATGGAGG - Intronic
1029443197 7:100599609-100599631 GAGCAGGAAGGGAGGGATAGTGG + Intronic
1029591254 7:101508564-101508586 GGGTGGGAAGGGAGGGTTGTTGG - Intronic
1030301305 7:107977110-107977132 GAGAAGGAAGGGAGGGAGGGAGG - Intronic
1030388881 7:108900759-108900781 GAATGAGAGGGGAGGGATGAAGG - Intergenic
1030438063 7:109551448-109551470 GAGTATGGGGGGAGGGAGGTGGG + Intergenic
1030925008 7:115441018-115441040 AAGGAGGAAGGGAGGGAGGTAGG + Intergenic
1031404902 7:121373456-121373478 TTGTAGGAGAGGAGGGATTTTGG - Intronic
1031796848 7:126185934-126185956 AAGTAGCAGGGGAGTGAAGTGGG + Intergenic
1032125561 7:129189880-129189902 GAGGAAAAGGGGAGGGATGACGG + Intronic
1032319616 7:130874162-130874184 GAGGAGGAGAGGGGAGATGTGGG + Intergenic
1032389713 7:131547981-131548003 GGGTAGGAGGGGAAGGACCTGGG - Intronic
1033041994 7:137927376-137927398 GAGAAGGAAGGGAGGGAAGGAGG + Intronic
1033309378 7:140249450-140249472 GAGCAGGAGGATAGGGATGGAGG - Intergenic
1033354926 7:140591951-140591973 GAGGGGGAGGGGAGGGGAGTAGG - Intronic
1033633775 7:143189152-143189174 TTGTAGGAGGGGAGGCATGCAGG + Intergenic
1033644209 7:143288364-143288386 GCGTCTGAGGGGAGGGATGTGGG + Exonic
1034347237 7:150394660-150394682 GAGGAAGAGGGGAGGGAGGGAGG - Intronic
1034418335 7:150976737-150976759 GAGGAGGCTGGGATGGATGTGGG - Intronic
1034866110 7:154643779-154643801 AAGAAGGAGGGGAGGGTTGAAGG + Intronic
1034895696 7:154875151-154875173 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1034950382 7:155292763-155292785 GAGAAGGAGGGGAGAGATGATGG - Intergenic
1034994878 7:155571160-155571182 GAGGAGGAGGGCCGGGATGGGGG - Intergenic
1035021275 7:155802409-155802431 GAGATGGAAGGGAGGGATGGCGG + Exonic
1035520855 8:274049-274071 GGGTAGGAAGTGTGGGATGTGGG + Intergenic
1035760445 8:2064774-2064796 GAGAAGGAGGAGGGGGATGGAGG - Intronic
1036005234 8:4654552-4654574 GGGGAGGAATGGAGGGATGTTGG + Intronic
1036644058 8:10601230-10601252 GAGGAGGAGGGGAGGAAGGGAGG + Intergenic
1037071531 8:14656326-14656348 GAGAAGGAAGGGAGGGATAGAGG - Intronic
1037097972 8:15008575-15008597 GAGGGGGAGGGGAGGGAGGAAGG + Intronic
1037356606 8:18026685-18026707 GAGGAGGAGGAGAGAGAGGTAGG - Intronic
1037457342 8:19076774-19076796 GAGAAGGAAGGGAGGGAGGAAGG - Intronic
1037567218 8:20128039-20128061 GAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1037799654 8:22025408-22025430 GAGGAGAAAGGGAGGGAAGTGGG - Intronic
1037805208 8:22055011-22055033 GAGAAGGAGGGGAGGGTGCTCGG - Intronic
1037912905 8:22754769-22754791 GTGAGGGAGGGGAGAGATGTGGG - Intronic
1037922708 8:22818741-22818763 CAGTAGCATGGGAAGGATGTTGG + Intronic
1038150959 8:24942146-24942168 AAGGAGAAGGGGAGGGAGGTGGG - Intergenic
1038240528 8:25803682-25803704 GAGCAGGTAGGGAGGGATGAGGG + Intergenic
1038339530 8:26673896-26673918 GAGGAGGAGGGGAGGGAGGAAGG - Intergenic
1038340374 8:26680738-26680760 GAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1038427580 8:27474191-27474213 AAGTAGGAGAAGAGGAATGTGGG + Intronic
1038542670 8:28402365-28402387 GAGAAGGAGGGGAGGGACGGAGG + Intronic
1038735711 8:30167150-30167172 CAGAAGGAAGGGAGGGAGGTAGG + Intronic
1038762413 8:30396497-30396519 CAGAACGAGGAGAGGGATGTGGG + Intronic
1040747286 8:50660502-50660524 GAGAAGGAAGGGAGGGAGGGAGG + Intronic
1040842992 8:51804320-51804342 GAGTAGAACGGGAGGAAGGTTGG + Intronic
1041191004 8:55354222-55354244 GAGTAGGAGGAGAGATATGGAGG + Intronic
1041330525 8:56719328-56719350 AAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1042120620 8:65484068-65484090 CAGTTGGATGGGAGGGATGGAGG + Intergenic
1042603455 8:70522926-70522948 GACTAGGAAGGGATGGATATAGG + Intergenic
1043052970 8:75405134-75405156 GAGTAGGGGTGGGGGGATGGGGG + Intergenic
1043417266 8:80063969-80063991 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1044325417 8:90852630-90852652 GAGGAGAAGCGGTGGGATGTTGG + Intronic
1044588435 8:93890159-93890181 GAGGTGGAGGGGAGGGATATCGG - Intronic
1045294157 8:100859570-100859592 GAGTACGAGGAGAGGCAGGTGGG - Intergenic
1045647814 8:104316525-104316547 GAGGAGTAGGGGAGGGAGCTGGG + Intergenic
1046199447 8:110903757-110903779 GTGTAGGAGGTGGGGGATGGTGG + Intergenic
1046677960 8:117133292-117133314 GAGTAGGATGGGGTTGATGTAGG - Intronic
1046983569 8:120362797-120362819 GAGTAGGAGGAGATGGAGGGAGG + Intronic
1047061799 8:121235636-121235658 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061806 8:121235652-121235674 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061813 8:121235668-121235690 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047081417 8:121465535-121465557 GAGAAGGAAGGGAGGGAGGTGGG + Intergenic
1047688100 8:127321762-127321784 GTGTTGGAGGTGAGGCATGTAGG + Intergenic
1048025866 8:130586148-130586170 GAGTAGGAGGTGAGGAAAGGAGG + Intergenic
1048529426 8:135234118-135234140 GAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1048816678 8:138340695-138340717 AGGGAGGAGGGGATGGATGTGGG - Intronic
1048870181 8:138790852-138790874 AAATAGGAGGGTAGGGACGTAGG - Intronic
1049023083 8:139970976-139970998 GAGAAGGAGGGGAAGGGTTTGGG - Intronic
1049035869 8:140075448-140075470 CTGGAGGAGGAGAGGGATGTGGG - Intronic
1049311787 8:141937403-141937425 GAGGAGGGAGGGAGGGAGGTGGG - Intergenic
1049361201 8:142213213-142213235 GAGTCGGAGGGGAGAGAGGGAGG - Intronic
1049479860 8:142816761-142816783 GAGTGGGAGGCGAGAGCTGTGGG - Intergenic
1049748817 8:144274053-144274075 GAGGAGAAGGGGAGGTAGGTGGG + Intronic
1050062049 9:1719653-1719675 GAGGAGGATGAGAGGCATGTGGG - Intergenic
1050696594 9:8286186-8286208 GAGGAGGAAGGAAGGAATGTTGG - Intergenic
1051860526 9:21620315-21620337 GGGAAGGAGGGAGGGGATGTGGG - Intergenic
1052037074 9:23694730-23694752 GAGACTGAGGGCAGGGATGTGGG - Intronic
1052730575 9:32280504-32280526 GAGAAGGTAGGGAGGGAGGTGGG - Intergenic
1053047741 9:34934523-34934545 GAGTAGGAAGGGGGGGCTGGGGG - Intergenic
1053273733 9:36767686-36767708 GAGAAGGAGTGGAGGGAGGGGGG + Intergenic
1053350655 9:37411406-37411428 GGGGAGGAGGGAAGGGAAGTGGG + Intergenic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053566377 9:39256877-39256899 GAGAAGGAAGGGAGGGAGGGAGG + Intronic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053820926 9:41966175-41966197 GAGGAGGGGGAGAAGGATGTGGG - Intronic
1053832158 9:42094737-42094759 GAGGAGGAAGGGAGGGAGGGAGG + Intronic
1054130770 9:61362135-61362157 GAGGAGGAAGGGAGGGAGGGAGG - Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054598387 9:67092687-67092709 GAGGAGGAAGGGAGGGAGGGAGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054850646 9:69843452-69843474 AAGTAGGAGGGGAGGGGAGGGGG - Intronic
1055353907 9:75417929-75417951 CACTAGGAGTGGAGGGCTGTGGG + Intergenic
1055570356 9:77610220-77610242 GAGAGGGAGGTGGGGGATGTAGG - Intronic
1056260058 9:84839978-84840000 AAGGAGGAAGGGAGGGATGTTGG - Intronic
1056420737 9:86424034-86424056 GAGTAGGAGAAGAGAGATGGGGG + Intergenic
1056482065 9:87015928-87015950 AAGTGGGAGGGGAGGGGTGGGGG + Intergenic
1056781644 9:89555242-89555264 AAGTAGGAGGGCAGGGAACTGGG - Intergenic
1056788537 9:89610569-89610591 GAGGAGGAAGGGAAGGATGTGGG - Intergenic
1057196761 9:93119854-93119876 GAGTTGGTGGGCAGGGAGGTTGG + Intergenic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057489355 9:95509243-95509265 GAGGAGGAGGGGAGGGGAGGGGG + Intronic
1057497418 9:95571969-95571991 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1057556939 9:96095502-96095524 GAGGAGGAGGAGAGAGATGATGG - Intergenic
1057556946 9:96095534-96095556 GAGGAGGAGGGGAAGGAAGGAGG - Intergenic
1057702991 9:97376986-97377008 GAGCAGGGGTGGAGGGATGAAGG - Intronic
1058555225 9:106159701-106159723 GATTAGGAAGAGAGGGATGGTGG + Intergenic
1059060733 9:111033338-111033360 GAGGAGGAGGGGTGGCATGGTGG - Intronic
1059086708 9:111310881-111310903 GAGGAGGGAGGGAGGGATGAAGG - Intergenic
1059373335 9:113861686-113861708 GAGAAGGAGGGGAGGGATGGAGG - Intergenic
1059669378 9:116478224-116478246 GAGTAAGGGGGGAGGGAGGGAGG + Intronic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1059693648 9:116710170-116710192 GATTGGGAGGTGAGGGGTGTAGG - Intronic
1059754161 9:117276673-117276695 GAGGAGGAAGGGAGGGCTGAGGG + Intronic
1060494718 9:124109991-124110013 GGGTAGGAGCTGAGAGATGTAGG + Intergenic
1060501108 9:124156568-124156590 GAGGAGGAGGGGGAGGAAGTGGG - Intergenic
1061007421 9:127936075-127936097 GAGGAGGTGGGTAGGTATGTAGG - Intronic
1061244152 9:129392616-129392638 GAGTCTGAGGGGTGGGAGGTGGG - Intergenic
1061312679 9:129774547-129774569 GAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1061397741 9:130352768-130352790 GACAAGGAGGGGAGGGGTCTGGG - Intronic
1061857319 9:133449427-133449449 GGGGAGGAGGGGAGGGCTGGCGG + Intronic
1061865664 9:133490768-133490790 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1061942517 9:133891331-133891353 GAATAGAAGGGAAGGGATGAAGG + Intronic
1061942652 9:133891684-133891706 GAATGGAAGGGGAGGGATGAAGG + Intronic
1062113334 9:134794742-134794764 GAGGAGGAGGGGAAGGAGGGAGG + Intronic
1062303225 9:135887574-135887596 GAGGCGGAGGGGAGGGATGCAGG + Intronic
1062441334 9:136571042-136571064 GCGAGGGAGGGGAGGGTTGTGGG - Intergenic
1062449180 9:136608364-136608386 GAGGAGGAAGGGAGGGAAGGAGG + Intergenic
1062469611 9:136696830-136696852 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469621 9:136696848-136696870 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469631 9:136696866-136696888 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469653 9:136696910-136696932 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469663 9:136696928-136696950 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469686 9:136696973-136696995 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1062469696 9:136696991-136697013 GGGAAGGAGGGGAGGGAGGAGGG - Intergenic
1062640423 9:137515750-137515772 GATTGGGAGGAGGGGGATGTGGG - Intronic
1185499105 X:584181-584203 GAGGAGGAGGGGAAGGAGGAGGG + Intergenic
1185581340 X:1213184-1213206 GAGGGGGAGGGGAGGGAGGAGGG - Intergenic
1185661922 X:1735183-1735205 GAGGAGGAGGGAAGGGAAGGAGG - Intergenic
1185778939 X:2829217-2829239 GCGAAGGAGGGGAGGGGTGCGGG + Intronic
1186095908 X:6101672-6101694 GGGTAGTGGGGGTGGGATGTGGG + Intronic
1186246534 X:7622121-7622143 GAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1186246693 X:7622742-7622764 GAGGAGGAAGGGAGGGAGGGAGG - Intergenic
1187453809 X:19423312-19423334 GGGTGGGATGGGAGGGAGGTAGG - Intronic
1189004644 X:36983102-36983124 GAGTAGGAGTGTAGGAGTGTAGG + Intergenic
1189014995 X:37087736-37087758 CAGAACGAGGAGAGGGATGTGGG + Intergenic
1189657089 X:43255827-43255849 AAGCAGGAGGGGAGGAGTGTGGG - Intergenic
1190110739 X:47587480-47587502 GAGAAGTAGGGGAGGGAGGATGG - Intronic
1190234462 X:48605056-48605078 GAGTAAGAGGGGTGGGATGGAGG - Exonic
1191044211 X:56118937-56118959 GAGGAGGAAGGGCAGGATGTAGG + Intergenic
1191754529 X:64580150-64580172 TAGGAGAAGGGGAGGGAAGTGGG + Intergenic
1191904893 X:66077228-66077250 GGGAAGGAGGGGAGGGAAGGAGG - Intergenic
1192182403 X:68924421-68924443 AAGTAGGAGGAGAGGGAAGGAGG - Intergenic
1192271872 X:69588535-69588557 GTTGAGGAGGGGAGGGATATGGG - Intergenic
1193453686 X:81702242-81702264 GGGTGGGGGGGGAGGGATTTAGG + Intergenic
1194056579 X:89142214-89142236 GAGTTGCAGGAGAGGGGTGTGGG + Intergenic
1195597664 X:106711165-106711187 GAGTAGGTGGGGAGAGAGGCTGG - Intronic
1197047072 X:122010371-122010393 GAGTGGAAGTGGAGGAATGTAGG + Intergenic
1197590009 X:128397061-128397083 CAAGAGGAGGGGAGGGAAGTGGG - Intergenic
1198687119 X:139238439-139238461 GAGTTGGGGGGGCGGGGTGTGGG - Intergenic
1198870832 X:141176296-141176318 GATTAGCAGGGGAGGGATCCCGG + Exonic
1199467979 X:148161347-148161369 GAGGAGGAGGGGGGTGATGAGGG - Intergenic
1199506112 X:148563186-148563208 GAGGATGAGGTTAGGGATGTAGG + Intronic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1200174309 X:154101798-154101820 GAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1201531195 Y:14991173-14991195 GAGTAGGTGGAAAGGGGTGTTGG - Intergenic
1201549995 Y:15209429-15209451 GAAGAGGAGGGGAGGGAAGGAGG + Intergenic
1201894869 Y:18982532-18982554 CAGTAGGAGAGCAGGGATGGTGG - Intergenic