ID: 1075757261

View in Genome Browser
Species Human (GRCh38)
Location 10:124822954-124822976
Sequence GTCTCAAAACAGTTAAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075757258_1075757261 26 Left 1075757258 10:124822905-124822927 CCACTCGTTGGTTGCTATCTAGA 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1075757261 10:124822954-124822976 GTCTCAAAACAGTTAAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075757261 Original CRISPR GTCTCAAAACAGTTAAAAGT TGG Intronic
No off target data available for this crispr