ID: 1075759581

View in Genome Browser
Species Human (GRCh38)
Location 10:124845907-124845929
Sequence CTGGAGAATGAGGATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075759581_1075759588 19 Left 1075759581 10:124845907-124845929 CCATCCTCATCCTCATTCTCCAG No data
Right 1075759588 10:124845949-124845971 CCTCCGGTGATGAAGTCCATGGG No data
1075759581_1075759586 18 Left 1075759581 10:124845907-124845929 CCATCCTCATCCTCATTCTCCAG No data
Right 1075759586 10:124845948-124845970 ACCTCCGGTGATGAAGTCCATGG No data
1075759581_1075759585 3 Left 1075759581 10:124845907-124845929 CCATCCTCATCCTCATTCTCCAG No data
Right 1075759585 10:124845933-124845955 ACATTTCTAAAAATGACCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075759581 Original CRISPR CTGGAGAATGAGGATGAGGA TGG (reversed) Intergenic
No off target data available for this crispr