ID: 1075760083

View in Genome Browser
Species Human (GRCh38)
Location 10:124849050-124849072
Sequence CAGCTGTAAGAGGAGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075760083_1075760089 5 Left 1075760083 10:124849050-124849072 CCTCCTGCCTCCTCTTACAGCTG No data
Right 1075760089 10:124849078-124849100 GCTCCAGACCATGACGGGCTTGG No data
1075760083_1075760093 26 Left 1075760083 10:124849050-124849072 CCTCCTGCCTCCTCTTACAGCTG No data
Right 1075760093 10:124849099-124849121 GGAGAATGTCAGCACAGGAAAGG No data
1075760083_1075760087 -1 Left 1075760083 10:124849050-124849072 CCTCCTGCCTCCTCTTACAGCTG No data
Right 1075760087 10:124849072-124849094 GTGTCTGCTCCAGACCATGACGG No data
1075760083_1075760092 21 Left 1075760083 10:124849050-124849072 CCTCCTGCCTCCTCTTACAGCTG No data
Right 1075760092 10:124849094-124849116 GGCTTGGAGAATGTCAGCACAGG No data
1075760083_1075760088 0 Left 1075760083 10:124849050-124849072 CCTCCTGCCTCCTCTTACAGCTG No data
Right 1075760088 10:124849073-124849095 TGTCTGCTCCAGACCATGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075760083 Original CRISPR CAGCTGTAAGAGGAGGCAGG AGG (reversed) Intergenic
No off target data available for this crispr