ID: 1075772375

View in Genome Browser
Species Human (GRCh38)
Location 10:124950550-124950572
Sequence ATGTTTGAGGCAAATCCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075772372_1075772375 11 Left 1075772372 10:124950516-124950538 CCCTTTTCTCATAACTTAATTGT 0: 1
1: 0
2: 2
3: 35
4: 498
Right 1075772375 10:124950550-124950572 ATGTTTGAGGCAAATCCATTTGG No data
1075772373_1075772375 10 Left 1075772373 10:124950517-124950539 CCTTTTCTCATAACTTAATTGTG 0: 1
1: 0
2: 1
3: 22
4: 345
Right 1075772375 10:124950550-124950572 ATGTTTGAGGCAAATCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075772375 Original CRISPR ATGTTTGAGGCAAATCCATT TGG Intronic
No off target data available for this crispr