ID: 1075773861

View in Genome Browser
Species Human (GRCh38)
Location 10:124966192-124966214
Sequence GACAGGGATGTGCTTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 192}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075773861_1075773870 24 Left 1075773861 10:124966192-124966214 CCAGCTGGAAGCACATCCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 192
Right 1075773870 10:124966239-124966261 TGAACGCAGGACCGGAACCAGGG No data
1075773861_1075773868 16 Left 1075773861 10:124966192-124966214 CCAGCTGGAAGCACATCCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 192
Right 1075773868 10:124966231-124966253 AGTCAGGATGAACGCAGGACCGG No data
1075773861_1075773867 11 Left 1075773861 10:124966192-124966214 CCAGCTGGAAGCACATCCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 192
Right 1075773867 10:124966226-124966248 TGCAGAGTCAGGATGAACGCAGG No data
1075773861_1075773865 0 Left 1075773861 10:124966192-124966214 CCAGCTGGAAGCACATCCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 192
Right 1075773865 10:124966215-124966237 TCCTTGGTTTCTGCAGAGTCAGG No data
1075773861_1075773869 23 Left 1075773861 10:124966192-124966214 CCAGCTGGAAGCACATCCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 192
Right 1075773869 10:124966238-124966260 ATGAACGCAGGACCGGAACCAGG No data
1075773861_1075773871 25 Left 1075773861 10:124966192-124966214 CCAGCTGGAAGCACATCCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 192
Right 1075773871 10:124966240-124966262 GAACGCAGGACCGGAACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075773861 Original CRISPR GACAGGGATGTGCTTCCAGC TGG (reversed) Intronic
900724291 1:4205155-4205177 GACTGGGCTGTGTTTCCATCTGG - Intergenic
901781490 1:11597662-11597684 GAAAGGGATGCGCTCCCAGGAGG - Intergenic
902562272 1:17284964-17284986 AACAGGGATGAGTTTCCAACAGG + Intergenic
904945207 1:34194015-34194037 GACAAGGAGGTGGTTGCAGCTGG + Intronic
906892494 1:49732161-49732183 GTCAGGGCTGTACTTCAAGCTGG - Intronic
907475901 1:54705333-54705355 GACAGGGACTGGCTTGCAGCAGG - Intronic
909466282 1:75977708-75977730 GACAGGGATTTGCATGCAGGAGG + Intergenic
915657877 1:157376633-157376655 ACCAGGGAGGTGTTTCCAGCCGG + Intergenic
915671180 1:157490340-157490362 ACCAGGGAGGTGTTTCCAGCTGG - Intergenic
923457186 1:234174683-234174705 TCCAGGGATGTGCTTTCTGCCGG - Intronic
1062834799 10:628642-628664 GAAGGGGCTGTGCTGCCAGCAGG + Intronic
1063463555 10:6229325-6229347 GACCGGCCCGTGCTTCCAGCAGG + Intronic
1063658691 10:8017508-8017530 GTCAGGGTTTTGCTTCCAACTGG - Intergenic
1066191737 10:33062225-33062247 AACAGGCAGGTGCTTCCAGCGGG + Intergenic
1070826625 10:79394011-79394033 GACAGAGATGTGCGGACAGCAGG - Intronic
1072288848 10:93943630-93943652 GACAGGGCAATGCTGCCAGCAGG + Intronic
1072546156 10:96441134-96441156 GACATGGCTGTGCCTTCAGCTGG - Intronic
1075046003 10:119147164-119147186 GACAGGGAGGCGCGCCCAGCAGG + Intronic
1075773861 10:124966192-124966214 GACAGGGATGTGCTTCCAGCTGG - Intronic
1075980418 10:126733743-126733765 GCCAGGTATGTGCTTGGAGCTGG - Intergenic
1076386096 10:130057026-130057048 TACAGGCATATGCTACCAGCAGG + Intergenic
1076893868 10:133299310-133299332 GAGAGACATGTCCTTCCAGCAGG + Intronic
1078031208 11:7753255-7753277 CACAGGGATGTGGTTGAAGCTGG + Intergenic
1078952803 11:16154045-16154067 GACAGGAATGTGATTTGAGCTGG - Intronic
1080544830 11:33306028-33306050 TAAAGTTATGTGCTTCCAGCCGG - Intronic
1084267303 11:68011699-68011721 GACAGGGATGTGGTGACAGAGGG - Intronic
1084916759 11:72434370-72434392 GCCATGGAGGTGCTTCCGGCCGG - Exonic
1086178170 11:83917614-83917636 CAGAGGGAAGTCCTTCCAGCAGG - Intronic
1087576187 11:99992797-99992819 GAGAGTAATGTGCTTTCAGCTGG + Intronic
1091385342 12:91177-91199 GGGAGGGAGGTGCTCCCAGCAGG - Intronic
1091692920 12:2609339-2609361 GACAGGGATGTGTTTCCCCACGG - Intronic
1095492049 12:42745131-42745153 GACAGGGCTGGGCTTGCAGGAGG - Intergenic
1096524960 12:52205055-52205077 GGAAGGGATGTGTCTCCAGCTGG - Intergenic
1096551179 12:52372797-52372819 GCCAGGGATCTGCCTGCAGCTGG + Intergenic
1099334744 12:81340647-81340669 GACAGGTATGTGCATCCTGTGGG - Intronic
1101575847 12:105995659-105995681 AACAGGGATGAGCCTCCTGCAGG - Intergenic
1101676670 12:106923346-106923368 GAGAGGTATGTACTTCCATCGGG + Intergenic
1105209454 13:18249306-18249328 GACAGAGATGGGCTTACAGTTGG + Intergenic
1105356331 13:19663354-19663376 CACAGGGAAGTGCTCCGAGCTGG + Intronic
1106592992 13:31113719-31113741 GATCGGGATGTGCATCCAGCAGG - Intergenic
1113216474 13:108046479-108046501 GAGAGGTATTTGCTTACAGCGGG - Intergenic
1113772082 13:112916857-112916879 GGCAGGGATGCTCTTCCAACTGG - Intronic
1119166918 14:72502289-72502311 GACTGGGCTGTGCATCCAGGAGG - Intronic
1119567808 14:75643674-75643696 GACAGGGAAGGCCTTTCAGCAGG + Intronic
1120872512 14:89350457-89350479 CAGAGGAATGTGCTTCCAGAAGG - Intronic
1122793556 14:104194644-104194666 GGAAGGGAAGTGCTTCCATCTGG + Intergenic
1202866370 14_GL000225v1_random:121289-121311 GTCTGGGATGTGCTTACAGGGGG + Intergenic
1123785101 15:23663591-23663613 GGCTGGGATGAGGTTCCAGCGGG + Intergenic
1126112726 15:45185175-45185197 AACAGGGATGTGCTTTGTGCTGG - Intronic
1127837208 15:62799574-62799596 AACAGGGATGAGCACCCAGCAGG - Intronic
1128404764 15:67324273-67324295 GACAGGCAAGTGTTACCAGCAGG - Intronic
1129334734 15:74845175-74845197 GACAGGGGCCAGCTTCCAGCAGG - Exonic
1129868702 15:78927597-78927619 CAAAGGGATGTGCTGCCAGAAGG + Intronic
1130150892 15:81310781-81310803 GACAGGGATGAGCATGGAGCTGG + Exonic
1130700571 15:86176364-86176386 CACATGCATGTGCTTTCAGCAGG - Intronic
1131072133 15:89472662-89472684 GACAGGGAGGTTCTCCCAGTGGG - Intronic
1131111276 15:89766673-89766695 GGCAGGGAGGTGCTCCCTGCTGG - Intronic
1132110493 15:99099186-99099208 GAAAGGGAAGTGCGTCGAGCTGG - Intronic
1132914014 16:2332378-2332400 GACGGGGATCAGCTACCAGCAGG + Intronic
1133872249 16:9700093-9700115 GAAAGGTATGTGCTTCCACTAGG - Intergenic
1137255140 16:46768962-46768984 GGCAGGGAAGTGCTGCCAGGAGG + Intronic
1137832033 16:51553132-51553154 GAGAGGGACTTCCTTCCAGCTGG + Intergenic
1138850838 16:60627605-60627627 TACAGGAAGGTGCTTCCACCTGG + Intergenic
1139203542 16:65003992-65004014 GTCAGGGAAATGCCTCCAGCTGG + Intronic
1139494093 16:67303378-67303400 GCCAGGGATCTGATTCCAGCAGG + Intronic
1141795518 16:86270783-86270805 GACAGGGATGAGCCTCCTGGGGG + Intergenic
1203143612 16_KI270728v1_random:1785090-1785112 GAGTTGGATTTGCTTCCAGCAGG - Intergenic
1146751865 17:35389306-35389328 GGCAGGGATGTGGATCCAGCTGG - Intergenic
1147522718 17:41189951-41189973 CACAGTGGTGGGCTTCCAGCAGG - Exonic
1147526256 17:41226719-41226741 CACAGTGGTGGGCTTCCAGCAGG - Exonic
1147527295 17:41238101-41238123 CACAGTGGTGGGCTTCCAGCAGG - Exonic
1147528419 17:41249785-41249807 CACAGTGGTGGGCTTCCAGCAGG - Exonic
1147528939 17:41255435-41255457 CACAGTGGTGGGCTTCCAGCAGG - Exonic
1147530428 17:41271375-41271397 CACAGTGGTGGGCTTCCAGCAGG - Intergenic
1147530840 17:41275747-41275769 CACAGTGGTGGGCTTCCAGCAGG - Exonic
1148977265 17:51540310-51540332 GCAAGGGACGTGCTTCCAGGAGG - Intergenic
1149022942 17:51991300-51991322 GACATGGATGTGTTTGCAGCTGG - Intronic
1150010048 17:61494904-61494926 GAAAAGAATGTGCCTCCAGCAGG + Intergenic
1151152381 17:72099148-72099170 GCCAGGGGTGTGCTTGCAGTTGG + Intergenic
1151499246 17:74478326-74478348 CACAGGCATGTGCTTCAAGGAGG + Intronic
1151685230 17:75642341-75642363 GACAGGGCTCTGCTCCCAGGTGG - Intronic
1152022651 17:77788759-77788781 GACAGGGCTCTGTTTCCACCTGG - Intergenic
1152092604 17:78255442-78255464 GACAGGGCTATGTCTCCAGCCGG + Intergenic
1152794087 17:82298441-82298463 GACAGGGAGGAGCTTGGAGCTGG - Intergenic
1154388516 18:13916869-13916891 GACAGGGAGAGACTTCCAGCAGG + Intergenic
1154436180 18:14343175-14343197 GACAGGCATGTGATCCAAGCTGG + Intergenic
1154490245 18:14916474-14916496 GAGAGGGAGATGCCTCCAGCTGG + Intergenic
1155268759 18:24119155-24119177 GATAGAGATGTGCTGCCACCTGG + Intronic
1157329943 18:46696383-46696405 GCCAGGGCTGTGTTTCCAGAAGG - Intronic
1157526830 18:48389675-48389697 CACAGGAATGTGGTTTCAGCTGG - Intronic
1159239963 18:65729658-65729680 CACAGAGGTGTGCTTCCAGATGG + Intergenic
1160080566 18:75723163-75723185 ATCAGGGAGGTGCTTCCAGTAGG - Intergenic
1161589090 19:5120754-5120776 GAGAGGGAAGGGCTCCCAGCGGG - Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1163903132 19:20125397-20125419 GACGGGGATCAGCTACCAGCAGG - Intronic
1166779366 19:45332763-45332785 GACGGGGATCAGCTACCAGCAGG + Intergenic
1167321377 19:48799134-48799156 GACAGGAATGTGGCCCCAGCTGG - Intronic
1167986695 19:53324409-53324431 GACAGGCATGTGCAACCAGTGGG - Intergenic
924963581 2:56782-56804 GGCAGGGCTGGGTTTCCAGCTGG + Intergenic
927706894 2:25302004-25302026 GCCAGGGATGCTCTTCCCGCTGG - Intronic
928270164 2:29848636-29848658 GAAAGGGAGAGGCTTCCAGCAGG + Intronic
928298610 2:30106645-30106667 GACAGGGATGTTCCTTCAGTTGG + Intergenic
933763069 2:85687422-85687444 GAGAGGGATCTGCTCCCAGCTGG + Intronic
933842431 2:86298295-86298317 CACAGGGATGGGCTCCCAACTGG + Intronic
943848847 2:192689581-192689603 CACAGGGATGTGCATGCAGAGGG - Intergenic
947437142 2:230082481-230082503 GATAGGGCTGTGCTTCCATAAGG - Intergenic
947552876 2:231059499-231059521 GAGAGAGAGGTGCTTCCAGGCGG + Intronic
947981726 2:234416047-234416069 GACAGGGAGGCGTTTCCAGAAGG + Intergenic
948157975 2:235799958-235799980 GACTGGGAGGTGCTTCCTGGAGG + Intronic
948261050 2:236604763-236604785 CACAGTGTTGTGGTTCCAGCAGG + Intergenic
1169533014 20:6505787-6505809 GAAGGGGATGTGCTTGTAGCAGG - Intergenic
1171290608 20:23980973-23980995 GACAGAGATGGGCTTACAGATGG + Intergenic
1172599018 20:36170882-36170904 GCCAGGCATTTGCTGCCAGCGGG + Intronic
1175024132 20:55883296-55883318 AGCAAGGATGTGGTTCCAGCAGG - Intergenic
1175298173 20:57923596-57923618 GAGAGGGATATGTTCCCAGCTGG - Intergenic
1175728662 20:61336865-61336887 GACTGGGATGTGCTTCTACTGGG - Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1177141153 21:17359581-17359603 GACAGGGATGTGCTACTTTCTGG - Intergenic
1178745335 21:35244276-35244298 GACAGGGGTCCTCTTCCAGCAGG + Intronic
1178875679 21:36412257-36412279 GACAGGGAAGTGCCCCAAGCTGG + Intronic
1179367646 21:40773085-40773107 GTCAGGGATGTGGTTTCAGCTGG - Intronic
1180248398 21:46563490-46563512 GACAGACATGTGCCTCCTGCAGG + Intronic
1180766813 22:18350094-18350116 GACAGAGATGGGCTTACAGATGG - Intergenic
1180779500 22:18512284-18512306 GACAGAGATGGGCTTACAGATGG + Intergenic
1180812216 22:18769605-18769627 GACAGAGATGGGCTTACAGATGG + Intergenic
1181198375 22:21203852-21203874 GACAGAGATGGGCTTACAGATGG + Intergenic
1181323052 22:22023330-22023352 GGCCAGGATGTGCTTCCTGCAGG + Intergenic
1181401370 22:22651947-22651969 GACAGAGATGGGCTTACAGATGG - Intergenic
1181648162 22:24244942-24244964 GACAGAGATGGGCTTACAGATGG + Exonic
1181703337 22:24633029-24633051 GACAGAGATGGGCTTACAGATGG - Intergenic
1181830254 22:25554943-25554965 GCCAGAGATGGGCTTTCAGCAGG - Intergenic
1182103635 22:27673983-27674005 GGCAGGGAAGTGGTTCCAGCAGG + Intergenic
1182807788 22:33090109-33090131 GACAGGGAATTGCTTGAAGCCGG + Intergenic
1183467429 22:37986759-37986781 GGCAGGGATGTGTTCGCAGCAGG - Intronic
1184915596 22:47566767-47566789 CTCAGGGATGTGTTTCCAGTGGG + Intergenic
1185299432 22:50071919-50071941 GACAGAGATGGGCTCCGAGCAGG + Intronic
1203228432 22_KI270731v1_random:90985-91007 GACAGAGATGGGCTTACAGATGG - Intergenic
949824046 3:8145961-8145983 GCCATGGATCTCCTTCCAGCAGG - Intergenic
950097948 3:10340843-10340865 GCCAGGGCTGTGCTGTCAGCTGG + Intronic
955166785 3:56522574-56522596 GCCACGGCTGAGCTTCCAGCAGG - Intergenic
957752202 3:84435295-84435317 GGCAGGGTTTTGCATCCAGCTGG - Intergenic
960519756 3:118641347-118641369 CACAGGGCTGTGCTTAGAGCAGG + Intergenic
961091105 3:124113594-124113616 GACTGGGATATGTTTCCTGCAGG + Intronic
961604197 3:128081777-128081799 GATGGGCATGTACTTCCAGCTGG - Intronic
969675373 4:8611493-8611515 GTCAGGGAGGGGCTTCCTGCAGG + Intronic
969701771 4:8771536-8771558 GGCAGGGAAGTGCTCCCAGCCGG - Intergenic
971421809 4:26480782-26480804 TACAGGCATGTGCTACCATCTGG - Intergenic
972251759 4:37309432-37309454 TACAGGGCTGTGATTCCAGTTGG - Intronic
980212828 4:129811932-129811954 GACAGAGATGAGCTTTCAGGGGG + Intergenic
985834212 5:2258843-2258865 GGATGGGATGTGCTTGCAGCAGG - Intergenic
987063724 5:14267395-14267417 GAGAAGTATGTGCTTCCAGGGGG + Intronic
987400281 5:17468373-17468395 CACAGAGCTGTGCTTCCACCTGG + Intergenic
989164083 5:38417847-38417869 CAGAGGGCTGTGCTTCCAGAAGG - Intronic
990097392 5:52134150-52134172 GGCAGGGAAGTGGTTCCAGATGG - Intergenic
992182016 5:74206800-74206822 GACAGAGATGTTATTTCAGCAGG + Intergenic
992206398 5:74434359-74434381 GACAAGGAGGTGTTTCCTGCAGG - Intergenic
993659453 5:90613500-90613522 GACAGGGAAGAGTTTGCAGCTGG + Intronic
998822966 5:146073415-146073437 GACACGGACATGCTTCCAGCTGG + Intronic
999281841 5:150371309-150371331 GCCAGGGATGTCCTTACAGCTGG - Intronic
1000234034 5:159341143-159341165 GAGAGTGATGTGATTCCAGGGGG + Intergenic
1000339002 5:160262593-160262615 GAATGGGCTGTGCTTCGAGCTGG + Intronic
1002076012 5:176708942-176708964 GCCAGGGATGCTCTTCCTGCAGG + Intergenic
1002199058 5:177516832-177516854 GACTGGCGTGTGCTTGCAGCGGG - Exonic
1005105860 6:22223526-22223548 GACAAGGGTCTGATTCCAGCAGG - Intergenic
1006513475 6:34533773-34533795 GACATGGAAGGGCTGCCAGCAGG - Exonic
1013391152 6:109687680-109687702 GGCTGAGATGTGCTTCCATCTGG - Intronic
1016836617 6:148483534-148483556 GACAGAGATGTGATTTCAGGAGG + Intronic
1018861189 6:167712078-167712100 AGCAGAGATGTGCTTCCAGGAGG + Intergenic
1022514884 7:30969197-30969219 GAAAGGGAGGTGCTTTCATCTGG + Intronic
1022907050 7:34867543-34867565 GACTTGGATGTGTTTCCAGTGGG - Intronic
1024394562 7:48850679-48850701 GTCAGAGAAGTGCTTTCAGCTGG - Intergenic
1024400698 7:48921962-48921984 GTCAGAGAAGTGCTTTCAGCTGG + Intergenic
1024828670 7:53422091-53422113 GACAGGGATGTGTTCCTAGTGGG + Intergenic
1026131538 7:67625248-67625270 GAGAGGGATGAGCTTCAAGAGGG - Intergenic
1026236145 7:68528882-68528904 GATAGGGATGTTCCTTCAGCTGG + Intergenic
1029148598 7:98464495-98464517 GACTGGGATTTGCTTTCAGTGGG + Intergenic
1029283034 7:99449001-99449023 GGCAGAGATGTGCTCCCTGCTGG + Intronic
1030128603 7:106178319-106178341 CACAGTGAAGTGCTGCCAGCTGG + Intergenic
1033032821 7:137844271-137844293 GAAAAGGAGGTGCTTCCATCTGG - Intronic
1033770604 7:144547095-144547117 GACAGTGATGAACTTCCTGCTGG - Intronic
1035335233 7:158123803-158123825 GATCGGGAAGTGCCTCCAGCAGG + Intronic
1035605485 8:927457-927479 GTCAGGAATGTGCTTTGAGCAGG + Intergenic
1037634958 8:20693316-20693338 CAGAGGGATCTGCATCCAGCAGG - Intergenic
1037803888 8:22049083-22049105 GGCCGGGACGTGCATCCAGCCGG + Intronic
1038514769 8:28177937-28177959 GCCAGGGTTGTGATTCCAACTGG - Intronic
1038927123 8:32153211-32153233 TACAGGGGCGAGCTTCCAGCTGG + Intronic
1039504411 8:38041580-38041602 CACAGGGTTGTGATTCCAGTCGG - Intronic
1048425259 8:134317641-134317663 GACAGGAAAGTACATCCAGCAGG + Intergenic
1048458651 8:134601722-134601744 AACATGGCTGTGCTTTCAGCTGG - Exonic
1049317735 8:141978215-141978237 GGAAGGGAGGTGCTTCCAGAAGG - Intergenic
1049962153 9:747189-747211 GAGAGGGATGTGCCTCCAGGTGG - Intergenic
1052391116 9:27879461-27879483 GACAGGGATGGGCTTCTTTCTGG + Intergenic
1054451868 9:65407589-65407611 GAGGGGGATGTGCTGGCAGCTGG - Intergenic
1057268024 9:93631661-93631683 AACAGGGCTGAGCTTCCAGTGGG + Intronic
1060985721 9:127818019-127818041 CACAGGGATGTGGGGCCAGCTGG - Intronic
1061289922 9:129644897-129644919 GACAGCGATTTGCATCCAGATGG + Intergenic
1061938567 9:133872024-133872046 GTCCTGGATGTGATTCCAGCTGG - Intronic
1062286876 9:135777285-135777307 GTCAGGGCTGTGGTTCCTGCTGG - Intronic
1062597515 9:137305909-137305931 GACCGGGATCTGCTTCCGGGAGG - Intergenic
1185549032 X:968770-968792 GAGTTGGATTTGCTTCCAGCAGG + Intergenic
1188243423 X:27814842-27814864 GACAGACATGTGCTTCATGCAGG - Intronic
1191670169 X:63741407-63741429 GACAGGGAACTGGTCCCAGCTGG - Intronic
1194084037 X:89504466-89504488 TACAGTGATCTGCTTCCAGCAGG + Intergenic
1197275161 X:124469622-124469644 GACAGGAAGATTCTTCCAGCTGG + Intronic
1198333621 X:135644970-135644992 GACAGGCATGTGTTTGCTGCTGG + Intergenic
1200436678 Y:3160352-3160374 TATAGTGATCTGCTTCCAGCAGG + Intergenic