ID: 1075775910

View in Genome Browser
Species Human (GRCh38)
Location 10:124987599-124987621
Sequence GTTACTGACCTATTACCCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075775910_1075775914 29 Left 1075775910 10:124987599-124987621 CCCTGGGGTAATAGGTCAGTAAC 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1075775914 10:124987651-124987673 TGTGTTAATAGACACTTTTATGG 0: 1
1: 0
2: 1
3: 20
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075775910 Original CRISPR GTTACTGACCTATTACCCCA GGG (reversed) Exonic
902609476 1:17588620-17588642 GGAACTGACCTCTTCCCCCAGGG - Intronic
906568328 1:46816022-46816044 GGGACTGACCTATAACTCCAGGG + Intronic
912160214 1:106973989-106974011 GTTTCTGACCTATTTCTCCAAGG - Intergenic
916611727 1:166398209-166398231 GTTATTCACCCATGACCCCATGG - Intergenic
922407328 1:225328763-225328785 GTTACTTACATATTAACGCATGG - Intronic
1065646335 10:27837949-27837971 GTAAGTGACATCTTACCCCACGG + Intronic
1075467940 10:122665487-122665509 GTTACTGCCCTGCTATCCCAGGG + Intergenic
1075775910 10:124987599-124987621 GTTACTGACCTATTACCCCAGGG - Exonic
1076436628 10:130450507-130450529 GTTTCTGATATATTAGCCCAGGG - Intergenic
1081543246 11:44051356-44051378 GTTCCTGACCTACTACTGCAGGG + Exonic
1083886339 11:65575167-65575189 CAAACTGACCTATTGCCCCAGGG + Intergenic
1089455008 11:118621050-118621072 GCCACTGACCTCTTACCACAGGG + Intronic
1092191540 12:6524916-6524938 GTAACTGACCTATGACATCATGG - Intronic
1092319267 12:7453735-7453757 CTTACTTAACCATTACCCCAGGG - Intronic
1100025665 12:90124851-90124873 GTTACTGACTTATTGCCTCTTGG + Intergenic
1101838192 12:108309774-108309796 GCAACTGGCTTATTACCCCAGGG - Intronic
1102994451 12:117337754-117337776 GATACTGGACTATTAGCCCAGGG - Intronic
1118320968 14:64753169-64753191 GTTATTATCCTATTATCCCAGGG - Intronic
1118547617 14:66909914-66909936 GTTGCTGTCCTATAAACCCAAGG + Intronic
1126814084 15:52437992-52438014 GTTTCTGACCTATTTCTCCTTGG - Intronic
1128553693 15:68615582-68615604 GTTAATGACCAATCACCCCAAGG - Intronic
1131026371 15:89145522-89145544 TTTACTGCCCTGATACCCCACGG - Intronic
1135508724 16:23062623-23062645 GTGACTTCCCTATTCCCCCACGG + Exonic
1135555784 16:23435479-23435501 GTTTCTGACATATTTCCCTAAGG + Intronic
1138693986 16:58794172-58794194 GTTCCTGACCTGTGACCCAATGG + Intergenic
1144450108 17:15370170-15370192 GGTACTGACCTCTGGCCCCAGGG + Intergenic
1157815352 18:50725981-50726003 GATCCTGACCTTTAACCCCATGG + Exonic
926351320 2:11997657-11997679 TTTACTGCCCAATTACCCTATGG + Intergenic
928383371 2:30840576-30840598 GTTAGTGTCCTACTACCCAAGGG - Intergenic
936455571 2:112671105-112671127 GTTACTGAACTGATACCCCATGG + Intergenic
936551442 2:113445388-113445410 GTTCCGGAACTAATACCCCATGG - Intronic
938188876 2:129256414-129256436 GTTACTGACCAATGACCCTCTGG + Intergenic
939247128 2:139639726-139639748 GTAAATGACCTTTTTCCCCAAGG - Intergenic
939263381 2:139838806-139838828 TTTATTGACATATTACCCCTTGG - Intergenic
939967305 2:148623099-148623121 TTTACTCATCTATTGCCCCAAGG + Intergenic
945461523 2:210115467-210115489 GTTACTGACTTCTTACTCCTTGG - Intronic
1176900477 21:14435686-14435708 CTTACTCACCTATTACACCTGGG + Intergenic
950124051 3:10500872-10500894 GTTTCTGACCCTTCACCCCAAGG + Intronic
952674756 3:36014380-36014402 GTTATTTACCTACTACACCAGGG - Intergenic
952696427 3:36269790-36269812 GTGACTGACCACTTACCCAATGG + Intergenic
953958211 3:47247444-47247466 CTTTGTGACCTATGACCCCATGG - Exonic
957029236 3:75221119-75221141 GTTTTTGACCTCTGACCCCATGG + Intergenic
958505153 3:94967402-94967424 GCTACTGAGCTACTACCACATGG - Intergenic
961816590 3:129553883-129553905 GTTACTGACATATTGTCGCATGG + Intergenic
962516351 3:136155641-136155663 GTTACTGTCCTGTATCCCCATGG - Intronic
968459081 4:714872-714894 GTTACTGACATACTGACCCATGG - Intronic
968712840 4:2132138-2132160 GCCACTGACTTAATACCCCAAGG - Intronic
977775586 4:100915666-100915688 GTTACTGAGCAATTCCCCCTAGG - Intergenic
981186595 4:141810888-141810910 ATTAATGAGCTATTCCCCCAGGG - Intergenic
983287235 4:165755110-165755132 GCTACTGACCTATTAGCTCTTGG - Intergenic
992332926 5:75736264-75736286 GATACACACCTATGACCCCAAGG - Intergenic
1000267706 5:159653556-159653578 GTTACCTACCTATAAACCCAAGG - Intergenic
1003860122 6:10315224-10315246 GTTCCCAACCTCTTACCCCAAGG - Intergenic
1006043678 6:31274828-31274850 GTTACCCATCTATTACCACATGG - Intronic
1006053257 6:31359823-31359845 GTTACCCATCTATTACCACATGG - Intergenic
1012271345 6:97216068-97216090 GTTACTCACCTTTTTCCACAAGG + Intronic
1014899527 6:126945906-126945928 GGTACTGACCTATTAGGCTAAGG - Intergenic
1016358854 6:143247038-143247060 GTTAATGCCCTATAACTCCATGG - Intronic
1021388725 7:20066036-20066058 TTTACTTTCCTATTACCCAAGGG + Intergenic
1037112780 8:15184978-15185000 GTAAATGCCCTATTACCTCAAGG + Intronic
1044538473 8:93384001-93384023 GTCACTGTCCTTTTACCCAATGG + Intergenic
1044908466 8:97030570-97030592 GTTACTGACCTACCAACCAAAGG - Intronic
1058009697 9:99963332-99963354 GTTACTGAACTACTGGCCCAGGG - Intronic
1190553909 X:51614758-51614780 TTTCCTTACCTATGACCCCAGGG + Intergenic
1199492253 X:148413273-148413295 CTTAATGACCTCTTAACCCAAGG - Intergenic