ID: 1075776211

View in Genome Browser
Species Human (GRCh38)
Location 10:124990615-124990637
Sequence AAGGGTCCATTGTACTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075776211 Original CRISPR AAGGGTCCATTGTACTCTGT TGG (reversed) Intronic
901354250 1:8629655-8629677 AAGTGTCCACTCTGCTCTGTAGG - Intronic
907963281 1:59303714-59303736 AGGGAACCATTGTACACTGTTGG - Intronic
908580239 1:65507816-65507838 AAGGAACCCTTGTACACTGTTGG - Intronic
908878044 1:68700096-68700118 AAGGAACCTTTGTACACTGTTGG - Intergenic
909808122 1:79896694-79896716 AAGGTACTATTATACTCTGTAGG - Intergenic
910351140 1:86298979-86299001 AGGGAACCATTGTACACTGTTGG - Intergenic
911823539 1:102450030-102450052 AAGGGACCCATGTACACTGTTGG + Intergenic
919693348 1:200547158-200547180 AGGGGGCCCTTGTACACTGTTGG + Intergenic
920235657 1:204502326-204502348 AAGGGATCTTTGTACACTGTTGG + Intergenic
921760505 1:218908423-218908445 AGGGGACCCTTGTACACTGTTGG - Intergenic
922279385 1:224108533-224108555 AAGGTCCTATTGTAGTCTGTTGG + Intergenic
924769747 1:247068536-247068558 AAGGAACCCTTGTACACTGTTGG + Intronic
1064394683 10:14972102-14972124 AAGAATCCATTGAACTCTGGAGG - Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1068828711 10:61468854-61468876 AGGGGTCCTGTGCACTCTGTGGG + Intergenic
1069274308 10:66570118-66570140 AAGGGTCCATTGGACTGTTTTGG - Intronic
1071413616 10:85420918-85420940 AAGGATCCACTGACCTCTGTCGG - Intergenic
1072028976 10:91498382-91498404 AAGGGTTCAGAGTACTCTCTAGG + Intronic
1075776211 10:124990615-124990637 AAGGGTCCATTGTACTCTGTTGG - Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1077991575 11:7416781-7416803 AAGGGACAATAGTACTCTCTTGG + Intronic
1079025880 11:16947218-16947240 AAGGGAACCTTGTACACTGTTGG + Intronic
1079168040 11:18065416-18065438 GAGGGTCCATTTTCCTCAGTGGG + Intergenic
1079756521 11:24271461-24271483 AGGGGTCCATTGTTCTATTTCGG + Intergenic
1081143359 11:39531941-39531963 AGGGAACCCTTGTACTCTGTTGG - Intergenic
1083041901 11:59696512-59696534 AGGGGACCCTTGTACACTGTAGG - Intergenic
1083380283 11:62262068-62262090 CATGGTCCATTCTTCTCTGTAGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084426607 11:69087463-69087485 CAGGGTCCATTGGATCCTGTTGG + Intronic
1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1086481848 11:87248315-87248337 AAGGAACCCTTGTACACTGTTGG - Intronic
1087366006 11:97219867-97219889 AAGAGTCCATTTTAATATGTGGG - Intergenic
1088925041 11:114293454-114293476 AGGGGACCCTTGTACACTGTTGG - Intronic
1088925061 11:114293665-114293687 AGGGGACCCTTGTACACTGTTGG + Intronic
1088943632 11:114486107-114486129 AAGGAACCCTTGTACACTGTTGG - Intergenic
1092397397 12:8139824-8139846 AAGGAACCTTTGTGCTCTGTTGG - Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092452615 12:8617114-8617136 AAGGAACCTTTGTACACTGTTGG - Intergenic
1093720624 12:22437683-22437705 GAGGGTGCAATGTACTTTGTGGG - Intergenic
1098582408 12:72115663-72115685 AGGGAACCATTGTACACTGTTGG - Intronic
1099288932 12:80750951-80750973 AAGGAACCCTTGTACACTGTTGG + Intergenic
1099403921 12:82236242-82236264 AAGGATCACTTGTACACTGTTGG - Intronic
1099669883 12:85676609-85676631 AAGCCTCCCTTGTACTATGTTGG + Intergenic
1099745318 12:86695295-86695317 AAGGAACCCTTGTACACTGTTGG + Intronic
1100675153 12:96858122-96858144 AAGGGAACATTATACACTGTTGG - Intronic
1100739022 12:97570789-97570811 AAGGGTCCCTAGGTCTCTGTGGG + Intergenic
1103047321 12:117747828-117747850 AAGGAACCCTTGTACACTGTTGG + Intronic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1107574844 13:41707621-41707643 AAGGCTCCAGTGAACTTTGTTGG - Intronic
1108028875 13:46207425-46207447 AAGAGTCCATTGTATTCTGTGGG - Intronic
1108930071 13:55807139-55807161 AAGGGCCCAGTGTAACCTGTTGG + Intergenic
1109893152 13:68644998-68645020 AACTTTCCATTGTAATCTGTGGG + Intergenic
1111696688 13:91633203-91633225 AAGGGCCCACTGTACCCTCTTGG + Intronic
1112625367 13:101097671-101097693 AATGGTGCTTTGTACTTTGTGGG + Intronic
1115457643 14:33623251-33623273 CACTGTCCATTGTACTTTGTGGG - Intronic
1116338678 14:43693772-43693794 AGGGATCCCTTGTACACTGTTGG + Intergenic
1118565834 14:67139914-67139936 AATGATACTTTGTACTCTGTGGG - Intronic
1122073491 14:99220806-99220828 AAGGGTCCACTGTGTGCTGTGGG - Intronic
1125473846 15:40030641-40030663 GAGGGGCCATTGTGCACTGTGGG + Intronic
1126380581 15:48042654-48042676 AAGGGGACATTGTATTCTGGTGG + Intergenic
1127069623 15:55275973-55275995 AAGGGAACCTTGTACGCTGTTGG + Intronic
1128183296 15:65623740-65623762 AGGGGTCCTCTGTACTATGTAGG - Intronic
1129660984 15:77552781-77552803 AAAGGCCCATTTTACCCTGTGGG + Intergenic
1130366301 15:83242678-83242700 AAGGGACCCTTGTACATTGTTGG + Intergenic
1133735080 16:8608798-8608820 GAAGGTCCATTGTCTTCTGTGGG + Intergenic
1136982776 16:35073392-35073414 AAGGGTCCATAGATCCCTGTTGG + Intergenic
1141226867 16:82125589-82125611 AGGGAACCATTGTACACTGTTGG + Intergenic
1146732808 17:35209954-35209976 TAGTGTACATTGTACTCAGTAGG - Intergenic
1147679053 17:42228001-42228023 AAGGGTTCTGTGTACTCTGAAGG + Intronic
1156699084 18:39801929-39801951 ATGTGTCCTTTGTAATCTGTAGG + Intergenic
1158171025 18:54599831-54599853 AAGGGACCCTTGTACACTGTTGG + Intergenic
1158244700 18:55418966-55418988 AATGGCCCAATGCACTCTGTTGG - Intronic
1162596218 19:11631397-11631419 AAGAGACCCTTGTACACTGTTGG + Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164320131 19:24137159-24137181 AAGGGTGCAGTGGCCTCTGTGGG + Intergenic
1166169260 19:41016031-41016053 AATGGGTCATTATACTCTGTGGG + Intronic
1167106293 19:47431736-47431758 AAGAGTCCATGGAACTATGTTGG - Intronic
1167644399 19:50697806-50697828 TAGGGTCCATTGAACACTGCTGG + Intronic
925376894 2:3392710-3392732 AAGGGACCCTTGTGCACTGTTGG + Intronic
927065923 2:19470919-19470941 AAGGGTGCATTTTACTCTGTGGG + Intergenic
930013317 2:46954408-46954430 AAGAGTCCACTGCACTCTGTGGG - Intronic
930284569 2:49411806-49411828 TAGTGTCCATTGTACTCATTAGG + Intergenic
930525281 2:52521364-52521386 AAGGGTCTTTTATACTCTGGTGG + Intergenic
930968424 2:57361584-57361606 AAGGGTCACTTTTATTCTGTAGG + Intergenic
931624585 2:64245310-64245332 AAGGGGCCATGGTAATCTGCAGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
935965019 2:108464510-108464532 AAGGGTCCCTTGACCCCTGTGGG - Intronic
936719182 2:115228991-115229013 AGGGGACCCTTGTACACTGTTGG - Intronic
937194467 2:120139705-120139727 AAGGAACCCTTGTACACTGTTGG + Intronic
938177357 2:129145891-129145913 AAGGAACCTTTGTACACTGTTGG - Intergenic
939149347 2:138455385-138455407 AAGGGTCTCTTGTATTCTTTTGG - Intergenic
940394976 2:153178322-153178344 AGGGAACCATTGTACACTGTTGG - Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
941126330 2:161588303-161588325 AAGGATCCCTTGTACACTGTTGG - Intronic
941170500 2:162130003-162130025 AAGAGACCCTTGTACACTGTTGG - Intergenic
941700089 2:168595077-168595099 AAGTGACCATTGTCCTCTATTGG + Intronic
942365324 2:175220152-175220174 AAGAGTCCATTTTTTTCTGTGGG + Intergenic
943873319 2:193030053-193030075 AAGGAACTATTGTACACTGTTGG + Intergenic
947075275 2:226336575-226336597 AAGGGAACCTTGTACACTGTTGG + Intergenic
947311118 2:228803542-228803564 AGGGAACCCTTGTACTCTGTTGG - Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
948240215 2:236425274-236425296 AGGGGACCCTTGTACACTGTTGG - Intronic
948420324 2:237856013-237856035 AACGTTCCATTGTATTCTGGTGG + Intergenic
948608622 2:239152642-239152664 AAGGGCCCATCTTGCTCTGTTGG - Intronic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1172065462 20:32216697-32216719 CTGGCTCCATTGTTCTCTGTAGG - Exonic
1176190680 20:63808281-63808303 AGGGGTCCCCTGTACCCTGTAGG + Intronic
1178180647 21:30157245-30157267 AAGTTTCCTTTGCACTCTGTTGG + Intergenic
1178432342 21:32527627-32527649 AGGGAACCCTTGTACTCTGTTGG + Intergenic
1179127284 21:38601276-38601298 AAGGCTCAGTTGTACACTGTGGG + Intronic
1180917031 22:19496572-19496594 AAGGTTCCATTGTCCTTTGAAGG + Intronic
1183617276 22:38953466-38953488 AAGGGTCCTTTTTACCATGTGGG + Intronic
950342398 3:12258883-12258905 AGGGAACCATTGTACACTGTTGG + Intergenic
951379069 3:21960463-21960485 ACGGATCCCTTGTACACTGTTGG + Intronic
951401770 3:22241300-22241322 AAGGGAACACTGTCCTCTGTAGG - Intronic
953560097 3:43981999-43982021 AAGGTACCCTTGTACACTGTTGG - Intergenic
954951281 3:54476521-54476543 AAGGGACCCTTGTATACTGTTGG - Intronic
955997186 3:64688839-64688861 GAGGGTCCATAGCATTCTGTAGG + Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
957706041 3:83785811-83785833 AAGGGTTCATTGTGATGTGTTGG - Intergenic
957992134 3:87639636-87639658 AAGGGAACATTATACACTGTTGG - Intergenic
958403606 3:93723943-93723965 AAGGGAACGTTGAACTCTGTGGG + Intergenic
960681884 3:120257053-120257075 AAGGGACCCTTGTACACTGTTGG + Intronic
960752479 3:120971328-120971350 TAGTGTACATTGTACTCAGTAGG + Intronic
963098356 3:141571012-141571034 AAAGGACCATAGTACTCTGAAGG - Exonic
963644648 3:147898121-147898143 GAGGGTCCATTGATCTCAGTTGG - Intergenic
964319274 3:155477773-155477795 AGGGAACCATTGTACACTGTTGG + Intronic
964975800 3:162618437-162618459 AGGGAACCATTGTACACTGTTGG - Intergenic
965823551 3:172708765-172708787 AAGGGTCCATTGTGGATTGTGGG - Intronic
966133248 3:176668325-176668347 AGGGGACCATTTTACACTGTTGG - Intergenic
966376805 3:179304699-179304721 AAGAGTCCTTTGCTCTCTGTCGG + Intergenic
967147670 3:186619971-186619993 AAGGGGTCATTGTATTCTGAAGG - Intronic
967288951 3:187900768-187900790 ATGGGTCCATTGTAAGGTGTAGG - Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
971067062 4:23045118-23045140 TAGTGTCCATTATATTCTGTTGG - Intergenic
971873925 4:32279864-32279886 AAGGAACAATTGTACACTGTTGG + Intergenic
973019071 4:45177729-45177751 ATGGATCCCTTGTACTCTTTTGG + Intergenic
973717887 4:53695339-53695361 CAGGGTCCATGGTACTCTTAGGG - Intronic
974595880 4:64014099-64014121 AAAAGTCCATTGTGCTCCGTGGG + Intergenic
975708006 4:77129799-77129821 AACGAACCATTGTACACTGTTGG - Intergenic
977016638 4:91699869-91699891 AAGGGTCCATAGACCCCTGTTGG + Intergenic
978035644 4:103990095-103990117 AGGGATCCCTTGTACACTGTTGG - Intergenic
979042791 4:115819249-115819271 AAGGAGCCCTTGTACCCTGTTGG - Intergenic
979506074 4:121498591-121498613 AAGGAACCCTTGTACACTGTTGG - Intergenic
979879423 4:125936454-125936476 AAGGAACCCTTGTACACTGTTGG + Intergenic
982111140 4:152055920-152055942 AAGGATCCCTTGCACACTGTTGG - Intergenic
982315946 4:154032021-154032043 AAGGAACCTTTGTACACTGTTGG - Intergenic
984481368 4:180307098-180307120 AAGGAACCATTTTACACTGTTGG - Intergenic
986034020 5:3921078-3921100 AAGGGCCCCTTGTACACTGTTGG + Intergenic
986079480 5:4375367-4375389 AGGGGACCACTGTACTTTGTAGG + Intergenic
986909851 5:12542587-12542609 AAGTGTCCATTTTATTCTTTAGG - Intergenic
986947582 5:13043431-13043453 AAGGAACCATTGTACACTGTTGG + Intergenic
987624754 5:20384429-20384451 AAGGCTAAATTGTATTCTGTTGG + Intronic
987860215 5:23476558-23476580 AGGGATCCCTTGTACACTGTAGG - Intergenic
992932321 5:81661464-81661486 AGGGAACCATTGTACACTGTTGG - Intronic
993287165 5:86014429-86014451 AAGGGGCCCTTGTACACTGTTGG - Intergenic
994613153 5:102071532-102071554 AAGGGTCCATTGAATTAAGTAGG + Intergenic
994991466 5:107001916-107001938 AAGGGTCCCTGGTATTCTGATGG + Intergenic
995213316 5:109565957-109565979 AGGGAACCCTTGTACTCTGTTGG + Intergenic
996115970 5:119618896-119618918 AGGGGACCTTTGTACACTGTTGG - Intronic
999977608 5:156927499-156927521 AAGTCTCCATTGGATTCTGTAGG + Intronic
1001653967 5:173335165-173335187 AAGGATCCATTGGACCCTGATGG + Intergenic
1001806998 5:174595411-174595433 AACTGTCCATTGTACAATGTTGG - Intergenic
1003355191 6:5362695-5362717 AAGGAACCACTGTACACTGTTGG - Intronic
1007412085 6:41670576-41670598 AAGGGAACATTTTACACTGTGGG - Intergenic
1007732880 6:43960195-43960217 AAGGGTCAATTGTATATTGTTGG + Intergenic
1007968163 6:46022981-46023003 AAGGGACCATTATATCCTGTGGG - Intronic
1008840050 6:55891991-55892013 AAGGAACCCTTGTACACTGTTGG + Intergenic
1009214700 6:60907160-60907182 AGGGATCCCTTGTACACTGTTGG - Intergenic
1009387603 6:63104785-63104807 AAGGAACCCTTGTACACTGTTGG - Intergenic
1010182406 6:73102824-73102846 AAGGAACCATTGTACACTGTTGG + Intronic
1010457231 6:76070856-76070878 TAGGGTACATTGTACTCATTGGG - Intronic
1010735564 6:79440226-79440248 AAGAGTCCAGTTTACTCTGCTGG - Intergenic
1013363177 6:109413486-109413508 AAGGGACCCTTGTACACTGTTGG + Intronic
1014476606 6:121880922-121880944 AAGGGTTTCCTGTACTCTGTTGG + Intergenic
1017355802 6:153506252-153506274 AATGGTCCATCTTACTCTGGTGG + Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1023554961 7:41412026-41412048 AAGGGAACCTTGTACACTGTTGG - Intergenic
1025638324 7:63343962-63343984 AAGTGTATGTTGTACTCTGTTGG - Intergenic
1025644372 7:63404127-63404149 AAGTGTATGTTGTACTCTGTTGG + Intergenic
1027996933 7:85435986-85436008 AAGGAACCCTTGTACACTGTTGG + Intergenic
1029010363 7:97254368-97254390 AAGGAACCCTTGTACACTGTTGG + Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1031037028 7:116798965-116798987 CAGTGTCCATTGTATTTTGTAGG - Intergenic
1031078456 7:117235205-117235227 AGGGGACCCTTGTACACTGTTGG - Intergenic
1031479411 7:122260199-122260221 CAGGGTTCCTTGAACTCTGTTGG - Intergenic
1033123216 7:138684638-138684660 AAGGAACCCTTGTACACTGTTGG + Intronic
1033367674 7:140683944-140683966 AAGGGGCCATTGTTCTCTGCTGG + Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036783247 8:11665232-11665254 AAGGGACCATTATACACTGCTGG - Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039218101 8:35296273-35296295 AAGGGAACCTTGTACACTGTTGG - Intronic
1040143499 8:43958057-43958079 AAAGGACCGTTGAACTCTGTGGG - Intergenic
1042412498 8:68481151-68481173 AAGGGGCCAATGTACAATGTGGG + Intronic
1042637808 8:70897496-70897518 AAGGAACCCTTGTACCCTGTTGG - Intergenic
1045727428 8:105190765-105190787 AAGGAACCTTTGTACACTGTTGG - Intronic
1046582988 8:116115998-116116020 AAGGGAAGATCGTACTCTGTAGG - Intergenic
1047192849 8:122694110-122694132 AAAAGTCCAATGCACTCTGTGGG - Intergenic
1048957373 8:139548132-139548154 AAGGGCCGATTGAACTCTGGGGG - Intergenic
1049123518 8:140763205-140763227 AAGTGTGCATTGTGCCCTGTGGG - Intronic
1050047861 9:1566901-1566923 AAGGAACCTTTGTACACTGTTGG - Intergenic
1050248638 9:3719510-3719532 AAGGAACCTTTGTACACTGTTGG + Intergenic
1050974927 9:11925997-11926019 AAGGGAACATTATACACTGTTGG + Intergenic
1051733821 9:20177464-20177486 AAGGGTCATTTGTGCTCTTTTGG - Intergenic
1051764197 9:20504082-20504104 AAGGATCCACTGTATACTGTTGG + Intronic
1052516677 9:29489893-29489915 AACGGTCCATTGGACTAGGTAGG - Intergenic
1052611310 9:30777852-30777874 AAGGAACCTTTGTACACTGTTGG + Intergenic
1052642156 9:31182208-31182230 AAGGGGCCCTTGTGCACTGTTGG + Intergenic
1052988926 9:34507191-34507213 AAGGGCCCACTGTACTCAGCTGG - Intronic
1053539388 9:38958182-38958204 AGGGGTCCATTTTAGTCGGTTGG - Intergenic
1054626753 9:67405736-67405758 AGGGGTCCATTTTAGTCGGTTGG + Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1057749182 9:97777362-97777384 AAGGGAGCCTTGTACACTGTTGG + Intergenic
1058040298 9:100295036-100295058 AAATGGCCATTGCACTCTGTGGG + Intronic
1061019186 9:128002987-128003009 AAGGGACCATTCTTCTCTGGAGG - Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1186382777 X:9078453-9078475 TAGGGTACATTGTACCCAGTAGG - Intronic
1186915430 X:14214361-14214383 AGGGAACCATTGTACACTGTTGG - Intergenic
1187071171 X:15889948-15889970 AAGAGACCCTTGTACACTGTTGG + Intergenic
1187654925 X:21461147-21461169 AAGGGAACCTTGTACGCTGTTGG - Intronic
1188591607 X:31843330-31843352 AAGGGAACATTATACGCTGTTGG - Intronic
1188635919 X:32431180-32431202 AAGGGCCCCTTGTACCCTGATGG - Intronic
1188739425 X:33759955-33759977 AGGGAACCCTTGTACTCTGTTGG - Intergenic
1189942862 X:46144461-46144483 AAGGAACCCTTGTACACTGTTGG + Intergenic
1192417151 X:70991810-70991832 AAGGAACCCTTGTACACTGTTGG - Intergenic
1193324338 X:80161967-80161989 AAGGGACGATTTTACACTGTTGG - Intergenic
1193829797 X:86276146-86276168 AAGGAACCCTTGTACACTGTTGG - Intronic
1193933989 X:87592474-87592496 AGGGGGCCCTTGTACACTGTTGG - Intronic
1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG + Intergenic
1194651049 X:96514857-96514879 AGGGGACCCTTGTACACTGTTGG + Intergenic
1194760357 X:97788776-97788798 AAGCTTCCATTGTAGTCAGTAGG - Intergenic
1194817897 X:98467540-98467562 AAGGAACCATTATACACTGTTGG + Intergenic
1196771215 X:119295929-119295951 AGGGAACCATTGTACACTGTTGG - Intergenic
1197090704 X:122533037-122533059 AAGGAACCCTTGTACACTGTTGG + Intergenic
1197469689 X:126851973-126851995 AGGGAACCATTGTACACTGTTGG - Intergenic
1199587463 X:149431337-149431359 ATGGGACCCTTGTACACTGTTGG + Intergenic
1199719343 X:150531129-150531151 AGGGGTCCAGTCCACTCTGTGGG - Intergenic
1199980831 X:152919586-152919608 AAGGGTCCATGGAACTTTGCTGG - Intronic
1201934322 Y:19390650-19390672 AAGGGAACATTTTACACTGTTGG - Intergenic