ID: 1075778631

View in Genome Browser
Species Human (GRCh38)
Location 10:125003325-125003347
Sequence AGGGTGGGCCCACCTTCTCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075778618_1075778631 6 Left 1075778618 10:125003296-125003318 CCCAAGGTCAGTGCAGGCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1075778631 10:125003325-125003347 AGGGTGGGCCCACCTTCTCGTGG 0: 1
1: 0
2: 0
3: 8
4: 90
1075778620_1075778631 5 Left 1075778620 10:125003297-125003319 CCAAGGTCAGTGCAGGCCCCGGC 0: 1
1: 0
2: 0
3: 20
4: 223
Right 1075778631 10:125003325-125003347 AGGGTGGGCCCACCTTCTCGTGG 0: 1
1: 0
2: 0
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075778631 Original CRISPR AGGGTGGGCCCACCTTCTCG TGG Exonic
900160004 1:1219029-1219051 AGGGTGGGGCCCCGGTCTCGCGG - Intronic
900726635 1:4220584-4220606 AGGTAGGGCCCACCTACTCCAGG + Intergenic
903168694 1:21538718-21538740 AGGGTGCGCCCACCTGGCCGGGG + Intronic
903655747 1:24947953-24947975 GGGGAGGCCCCACCTTCTCCCGG + Intronic
911765739 1:101672434-101672456 AGTGTGGGCCCACCCACTTGAGG - Intergenic
913194608 1:116445150-116445172 AGGCTGGGGCCACCTTGTAGAGG - Intergenic
915146566 1:153799200-153799222 TGGGTGGCCCCACCTTCCCTGGG - Intergenic
916465987 1:165075273-165075295 AGGGTGGGGCCTACTTCTCCAGG + Intergenic
917161576 1:172062579-172062601 AGTGTTAGCCCACCTTCTCCAGG - Intronic
918202366 1:182279387-182279409 AGGAAGGGCCCACCTTCTCCTGG - Intergenic
1073566532 10:104540074-104540096 AGGGTTTGCCCACCTTCTGGGGG - Intergenic
1075731232 10:124637945-124637967 AGGGAGGGCCCACCAGCTCCTGG - Intronic
1075778631 10:125003325-125003347 AGGGTGGGCCCACCTTCTCGTGG + Exonic
1076216298 10:128696225-128696247 ACGGTGGGGCCACCTTCCCCAGG + Intergenic
1080935469 11:36858411-36858433 TGGGAGGGCCCATTTTCTCGTGG + Intergenic
1083227388 11:61293887-61293909 AGGGGGGGCCCTCCTGCTGGCGG + Intronic
1083981607 11:66175701-66175723 AGGGTGGTGTCACCTTCTCCAGG + Intronic
1084033494 11:66494318-66494340 TGGGTGGGTCCTGCTTCTCGGGG + Intronic
1089394395 11:118126452-118126474 AGGGTGGGGGCACCTTCTTGTGG - Intergenic
1091172365 11:133530255-133530277 AGGGTGAGACCTCCTTCTAGGGG - Intronic
1092895981 12:13010730-13010752 AGGGTGGGCCCACCCTGAAGAGG - Intergenic
1099826224 12:87780551-87780573 AGGCAGGGCCCAGCTTCTGGGGG - Intergenic
1102476457 12:113191770-113191792 TGGGTGGCCCCACCTCGTCGTGG - Exonic
1112325566 13:98440935-98440957 TGGGTGGCCCCACCTACCCGCGG + Intronic
1112371401 13:98796883-98796905 AGAGCGGGCCCGCCTCCTCGTGG - Intronic
1121182162 14:91937312-91937334 AGGGTGGTCCCAACTCATCGCGG + Intronic
1129345029 15:74912020-74912042 ATGGTGGGGCCACCTTTTCCTGG - Intergenic
1129945362 15:79534864-79534886 AGGGTGGGCCCCCATCCTGGGGG - Intergenic
1132469377 16:93420-93442 AGGCTGGGGCCAGCTTCTCCAGG - Intronic
1132679041 16:1132244-1132266 AGGGTGTGCTCACGTTCTGGGGG + Intergenic
1133229339 16:4359283-4359305 AGGGTGGCCTCACCTTGTGGGGG + Exonic
1134914735 16:18060197-18060219 AGGGTGGGACCACCTTGGCCTGG - Intergenic
1139352168 16:66343568-66343590 ACTGTGGGACCACCTTCTCCAGG + Intergenic
1139686271 16:68606022-68606044 AGGCTTGGCCCACCTCCACGGGG - Intergenic
1140127025 16:72125955-72125977 GGTGTGGCCTCACCTTCTCGAGG + Exonic
1142769536 17:2086706-2086728 AGTCTGGGCCCCCCTTCTGGAGG + Intronic
1148798462 17:50208909-50208931 AGGCTGGGGCCAACTTCTGGAGG + Intergenic
1151312955 17:73305312-73305334 AGGCTGGGCCCTCCTCCTCTAGG + Intronic
1158907805 18:62030886-62030908 AGGATGGTCCCAGCTACTCGAGG + Intergenic
1160235535 18:77083095-77083117 ATGGTGGTCCCAGCTACTCGGGG - Intronic
1160498974 18:79393245-79393267 AGGGTGGGCGCACCTGCCCCTGG + Intergenic
1166496996 19:43310629-43310651 ATGGTGGGTCCATCTTCTCTTGG + Intergenic
1166749899 19:45159689-45159711 AGGCTGGGCCCAGTTTCTGGTGG - Intronic
925342529 2:3147304-3147326 GGGGTGGGCCCAGCTCCCCGAGG - Intergenic
934067005 2:88350060-88350082 GGGGTGGGGCCGCCTTCTGGAGG + Intergenic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
943470995 2:188292898-188292920 TGGCCGGGTCCACCTTCTCGTGG + Exonic
944518176 2:200533459-200533481 AGTGTGAGCCCACCTCCTCAAGG - Intronic
1172311558 20:33922328-33922350 TTGGTGGGCCCACCTTCTGCTGG + Intergenic
1173225759 20:41161694-41161716 AGGGTGGGACCACCTCCTCTGGG - Intronic
1173847239 20:46195967-46195989 ATGGTGGCCCCACCTGCTCCTGG - Intronic
1174606898 20:51768026-51768048 GGGGCGGGCCCGGCTTCTCGGGG + Intronic
1177228722 21:18291299-18291321 AGTGTGGGCCAACCTTCCTGTGG - Intronic
1181164631 22:20976757-20976779 GGGGTGGGCTCACCTTCATGAGG - Exonic
1182899746 22:33887996-33888018 AGGGTGGGGCCACCATCTTCAGG - Intronic
1182930161 22:34166005-34166027 AGGGAGGGCACACTTTCCCGTGG + Intergenic
1183933933 22:41251073-41251095 AGGCAGAGACCACCTTCTCGGGG + Exonic
1184773053 22:46609267-46609289 AGCCTGGGTCCACCTTCTCCTGG + Intronic
949838306 3:8292854-8292876 AGGGTGGGCCCCTCTGCTGGTGG + Intergenic
950630169 3:14276858-14276880 GGGGTCTGCCCACCTTCTCAGGG + Intergenic
952751816 3:36831038-36831060 TGGCCGGGTCCACCTTCTCGTGG + Exonic
952968113 3:38633409-38633431 AGGGTGGGCAGACCTCCTGGGGG + Intronic
954688802 3:52384968-52384990 CGCCTGGGCCCACCTTGTCGAGG - Exonic
968731324 4:2270661-2270683 AGCGTGGCCCCACCTTCCTGGGG + Exonic
968911780 4:3480087-3480109 TGGGTGGGCTCACCCTCTCTGGG - Intronic
973343895 4:49033406-49033428 AGGGTAGGCCCACCATTTAGGGG - Intronic
985890837 5:2714264-2714286 TGGGTGGGCTCTCCTGCTCGGGG - Intergenic
989831658 5:45926955-45926977 ATGGTGGGCACACCTTCCCCAGG - Intergenic
991634318 5:68689168-68689190 AGTGTGGGCTCACCTTTTCCAGG + Intergenic
992127007 5:73652520-73652542 AGGGTGGGGCCACATTCAGGAGG + Intronic
1000068728 5:157719537-157719559 TGGGTGGGCCCACTTTCTAATGG + Intergenic
1001241896 5:170077652-170077674 AGGCTGGGGCCACCTTCCCCAGG + Intronic
1015098932 6:129451392-129451414 AGGCTGGCCCCACCTTTTTGGGG + Intronic
1018035594 6:159878607-159878629 AGGGAGGGCCCACCTCCCCCGGG + Intergenic
1018617513 6:165702121-165702143 AGGGTGGTGCCACCTCATCGTGG + Intronic
1018712912 6:166509470-166509492 AGGGTGTGCCCAGCTTCTGCAGG + Intronic
1024525372 7:50344050-50344072 AAGCTGGGCTCACCTTCTGGAGG - Intronic
1025028482 7:55536955-55536977 AGGGAGGCCCCACCTTCCCCTGG - Intronic
1034927428 7:155133435-155133457 AATTTGAGCCCACCTTCTCGAGG + Intergenic
1035123088 7:156585317-156585339 AGGGGGGGCCCACACTCTCGTGG + Intergenic
1041186397 8:55305332-55305354 AGGGTGGGCCCCAGTTCTCCTGG + Intronic
1041547237 8:59059290-59059312 AAGGTAGCCCCACCTTCTCCAGG - Intronic
1043316675 8:78931483-78931505 AGAGAGGGCCCTCCTTCTCTTGG + Intergenic
1044749513 8:95402532-95402554 AGGGTGGACGCTCCTTATCGGGG - Intergenic
1047959595 8:130001273-130001295 AGGGTGTGCCCAACTTCTCTTGG - Intronic
1048583986 8:135755776-135755798 AGGGTGGGCCCTGCTTCTCTGGG + Intergenic
1049593643 8:143473672-143473694 CGGGTGGTCCCACCTTCCCCTGG - Intronic
1049843806 8:144790168-144790190 AGGGTGAGCCCACCTCCTTCAGG + Intronic
1050426716 9:5519019-5519041 ATGGTGTGCCCCCCTTCTCTTGG - Intronic
1052991270 9:34520603-34520625 ATGGTGGGCCCCCCCTCTCTGGG - Intronic
1054905681 9:70412529-70412551 GGGGTGGCCCCACCGTCGCGGGG + Intronic
1055587394 9:77769449-77769471 AGGGTGGGCACAGCTGCTGGAGG + Intronic
1057183015 9:93039985-93040007 AGGGTGGGCTCACCTCCCCTCGG + Intergenic
1059115886 9:111599684-111599706 GGGGTGGCCCCACCCTCTCTTGG - Exonic
1062339966 9:136089543-136089565 AGGGTGGGTTCACCTTCTTGGGG - Intronic
1062362126 9:136193172-136193194 AGGGTGGAGACGCCTTCTCGCGG - Intergenic
1185637100 X:1560741-1560763 AGAGTGGGCACACCTTCACAAGG - Intergenic
1186497826 X:10025934-10025956 GGGGTGGCCACACCTTCTCTCGG + Intronic
1186933083 X:14416220-14416242 AGGGTGGGAAGACCTTCTCTGGG - Intergenic