ID: 1075779271

View in Genome Browser
Species Human (GRCh38)
Location 10:125006335-125006357
Sequence CGTGCCCTGCATGAGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075779257_1075779271 26 Left 1075779257 10:125006286-125006308 CCGGGCACGACGGCTGGAGGTGG 0: 1
1: 0
2: 1
3: 13
4: 150
Right 1075779271 10:125006335-125006357 CGTGCCCTGCATGAGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075779271 Original CRISPR CGTGCCCTGCATGAGGTGCA GGG Intronic
No off target data available for this crispr