ID: 1075783002

View in Genome Browser
Species Human (GRCh38)
Location 10:125029013-125029035
Sequence CATGGGAATCCTGCAGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075783002_1075783008 28 Left 1075783002 10:125029013-125029035 CCTGCAACTGCAGGATTCCCATG 0: 1
1: 0
2: 0
3: 11
4: 162
Right 1075783008 10:125029064-125029086 CGGTGATTAGGAAGCTACAAAGG No data
1075783002_1075783005 8 Left 1075783002 10:125029013-125029035 CCTGCAACTGCAGGATTCCCATG 0: 1
1: 0
2: 0
3: 11
4: 162
Right 1075783005 10:125029044-125029066 TTCATAGCAAAAATAAAAGCCGG No data
1075783002_1075783006 16 Left 1075783002 10:125029013-125029035 CCTGCAACTGCAGGATTCCCATG 0: 1
1: 0
2: 0
3: 11
4: 162
Right 1075783006 10:125029052-125029074 AAAAATAAAAGCCGGTGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075783002 Original CRISPR CATGGGAATCCTGCAGTTGC AGG (reversed) Intronic
900515382 1:3079394-3079416 CACAGGGATCCTGCGGTTGCAGG + Intronic
901238401 1:7679636-7679658 CCTGTGTATCCTGCAGGTGCAGG - Intronic
901807136 1:11745640-11745662 CCTGGGCCACCTGCAGTTGCTGG + Intronic
902010655 1:13268264-13268286 AGTGAGAATCCTGCAGTTTCGGG + Intergenic
902457262 1:16543675-16543697 CATGGAAGTCCTTCAATTGCTGG - Intergenic
902483958 1:16729591-16729613 CATGGAAGTCCTTCAATTGCTGG + Intergenic
902494904 1:16864235-16864257 CATGGAAGTCCTTCAATTGCTGG + Intronic
906793853 1:48681315-48681337 CATGTGAATCCTGCCCTTGTAGG + Intronic
906947738 1:50309761-50309783 CTTGGGAATCCTGCAGAGGAAGG - Intergenic
907600062 1:55760347-55760369 CATGGGAATAGTGCAGTATCTGG - Intergenic
908437408 1:64120220-64120242 CATGGAAAGCCTGGAGTTGGGGG + Intronic
910738750 1:90492445-90492467 AATGGGTACCCTGCAGTTGTTGG + Intergenic
911732799 1:101307817-101307839 AATGGGAAGCCAGCAGTGGCTGG + Intergenic
917567494 1:176228227-176228249 AATGTGAATTCTGCAGTTGTTGG + Intergenic
917959072 1:180128313-180128335 CATGGGAGGCCTGCTCTTGCTGG - Intergenic
920257174 1:204663499-204663521 CATGGGGATCCTTCACTTGGTGG + Intronic
921190527 1:212704177-212704199 CATGAGCCTCCTGCAGTTTCTGG - Intergenic
922891059 1:229062283-229062305 CAGGGGCATCCTGCACTAGCAGG - Intergenic
922896706 1:229106382-229106404 CATGGGCACCCAGCAGTTCCTGG + Intergenic
924102827 1:240621976-240621998 GATGGAAATGCTGCAGCTGCAGG - Intergenic
1062984732 10:1757666-1757688 CATGGGCAGCCTGGAGTTGATGG + Intergenic
1064680892 10:17809697-17809719 CATGGGAGGCCTGGAGTTGGAGG + Intronic
1065045321 10:21742854-21742876 CATGGGAAGGCTGCAGGTGACGG - Exonic
1065427358 10:25619453-25619475 CATGGGAAAACTGCAGTATCTGG - Intergenic
1073878200 10:107950055-107950077 CATGCGATTCCTGCACGTGCTGG + Intergenic
1074256171 10:111804699-111804721 CCTGGGAATCCTGCGGATGCTGG + Intergenic
1075783002 10:125029013-125029035 CATGGGAATCCTGCAGTTGCAGG - Intronic
1076273598 10:129177637-129177659 CATGGTAATGCTGAACTTGCAGG - Intergenic
1077391554 11:2302791-2302813 CATGGGACTGCTGCAGGAGCAGG - Intronic
1078416429 11:11170021-11170043 CATGGGGATGCTGGAGTTGTGGG - Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079550064 11:21684258-21684280 CCTGGAGATCCTACAGTTGCAGG + Intergenic
1080160621 11:29170956-29170978 TATGGCAATCCAGCCGTTGCAGG + Intergenic
1084277236 11:68059844-68059866 AATGTGCACCCTGCAGTTGCTGG + Intronic
1084872675 11:72108721-72108743 CATGGGCCTCCAGCAGCTGCAGG - Exonic
1087035800 11:93755273-93755295 CATGTGAACCCTGCAGATGGAGG + Exonic
1088206663 11:107399745-107399767 AATGTGTATGCTGCAGTTGCTGG - Intronic
1089217555 11:116843959-116843981 CATGGCCATCCTGATGTTGCTGG - Intronic
1089218027 11:116847491-116847513 CATGGGCAGCCAGCAGTTTCAGG - Exonic
1090700162 11:129287283-129287305 CATTGGGTTCCTGCTGTTGCTGG - Intergenic
1091210243 11:133851912-133851934 AATGTGTATTCTGCAGTTGCTGG + Intergenic
1094124952 12:27014147-27014169 AATGGGGTTCCTGCAGCTGCTGG - Exonic
1095880218 12:47127806-47127828 AATGGGAATTCTGCTGTTGTTGG + Intronic
1096033541 12:48442815-48442837 GATGGGAAACCTGCTGCTGCTGG - Intergenic
1098633906 12:72757498-72757520 CATGGCAATCCTGCTGCTGTGGG - Intergenic
1101834496 12:108285982-108286004 CATGTTAATGCTGCAATTGCAGG - Intergenic
1101988489 12:109465786-109465808 CATGGGAAAACTGCAGTTCCTGG - Intronic
1102119580 12:110429767-110429789 CATGGGAGCCCTGCAGTGGCTGG + Intergenic
1104066911 12:125313761-125313783 CATGGGACTGGAGCAGTTGCAGG + Intronic
1109998027 13:70155168-70155190 CATGGTAATCGTGCAATTGATGG + Intergenic
1110564285 13:76942206-76942228 CAGAGAAATCCTGCAGTTGAGGG + Intergenic
1113550334 13:111188063-111188085 CATAGGATTCCTGAAGCTGCAGG + Intronic
1114920802 14:27325993-27326015 AACGTGAATCCTGCTGTTGCTGG + Intergenic
1115905812 14:38201866-38201888 CATGGGGATTCTGCAGATGTAGG - Intergenic
1117915204 14:60671176-60671198 AATGCGTATTCTGCAGTTGCTGG + Intergenic
1119582451 14:75798926-75798948 AATGTGTATTCTGCAGTTGCTGG + Intronic
1119609844 14:76052438-76052460 CATGGGGTCCCTGCAGTTGGGGG + Intronic
1126794982 15:52253331-52253353 AATGGGAATTCTGGAGTTACTGG - Exonic
1128206861 15:65860574-65860596 AATAGGAATCATGCAGTTGGAGG + Intronic
1132077984 15:98838900-98838922 CGTGGGGATCCTGCTTTTGCTGG + Intronic
1132557917 16:580582-580604 CCTGGGAATCAAGCAGGTGCTGG - Intronic
1136020113 16:27434721-27434743 CATGGGAAGCGTGTAGTTGGGGG - Intronic
1137507499 16:49066981-49067003 CATGTGTAGCCTGCTGTTGCAGG + Intergenic
1137584700 16:49657448-49657470 CCTGGGAATTCAGCAGCTGCAGG + Intronic
1142506515 17:367104-367126 AACGTGCATCCTGCAGTTGCTGG + Intronic
1143499893 17:7332464-7332486 CATGGCAATCCTGAAGGGGCAGG - Intergenic
1143976208 17:10831804-10831826 CAGGAGAAGCCTGGAGTTGCAGG + Intronic
1144672501 17:17140871-17140893 CCTGGGAACCCTGGAGCTGCAGG + Intronic
1145785416 17:27590737-27590759 CATGGGAAACCTTCTGTGGCTGG + Intronic
1152451407 17:80383294-80383316 CCTGGGAATCCAGCAAGTGCAGG + Intronic
1152636242 17:81431587-81431609 CCTGGGAACCCTGAAGCTGCAGG - Intronic
1153436045 18:5069062-5069084 CATCTGAATCATGCATTTGCGGG + Intergenic
1155682311 18:28503329-28503351 CTTGGGAATACTCCAGTTGAAGG + Intergenic
1157860266 18:51134877-51134899 CTTGGGAATGTGGCAGTTGCTGG - Intergenic
1158431611 18:57392913-57392935 AATGTGTATCCTGCAGTTGTTGG - Intergenic
1159019148 18:63128750-63128772 CAAAGGCATCCTGCAGTTGGGGG + Exonic
1164807079 19:31125290-31125312 CCTGGGAAGCCTGCAGATGCTGG + Intergenic
1164915715 19:32050963-32050985 CATGGGAAGTCTGCAGCTACAGG - Intergenic
1167180302 19:47898077-47898099 CAGAGGACTCCTGCATTTGCAGG + Intergenic
1202708221 1_KI270713v1_random:40236-40258 CATGGAAGTCCTTCAATTGCTGG - Intergenic
927462428 2:23310602-23310624 CATGAAAGTCCTACAGTTGCAGG - Intergenic
928432913 2:31234940-31234962 AATGGGAAGCCTTCAGTTGAGGG + Intronic
929037107 2:37704706-37704728 AATGTGTATTCTGCAGTTGCTGG + Intronic
929836952 2:45411041-45411063 CATAGGAATCCTGAAGTTACAGG + Intronic
930205816 2:48585789-48585811 CAGGGGAAACCTGCAGATCCAGG - Intronic
930579239 2:53189980-53190002 CATGTGACTTATGCAGTTGCAGG + Intergenic
932414099 2:71563554-71563576 CATGGGAGTCCTGCTGCTACGGG + Intronic
934777964 2:96950897-96950919 CACGGCAATCCTGCAGTGCCTGG - Intronic
935649723 2:105371949-105371971 CATGTGGATCCTGCAGAGGCTGG - Intronic
937977031 2:127588670-127588692 CTTGGGAATCCTGCAATGGATGG + Intronic
938116636 2:128606929-128606951 CATGGGAGTCCAGGAGTGGCAGG + Intergenic
939648396 2:144730786-144730808 CCTGGGAATACAGGAGTTGCAGG - Intergenic
941067467 2:160919453-160919475 CATGGGCATCTTGCAGGTGTGGG + Intergenic
942461519 2:176171740-176171762 CAAGGGCATCCTGCACTCGCCGG + Exonic
943523907 2:188992902-188992924 CCAGGGAATCCGGCAGTTCCAGG - Exonic
944389675 2:199204653-199204675 AAAGCCAATCCTGCAGTTGCTGG - Intergenic
944551091 2:200845343-200845365 CATGGTCATCCTGCAGAAGCTGG + Intergenic
948128352 2:235581840-235581862 CATGGAGATCCTGCAGTCACGGG + Intronic
948910930 2:241002363-241002385 CAAGGGGCTCCTGCATTTGCTGG - Intronic
1170123129 20:12933399-12933421 GGTGGGCATCCTGCAGTTGGTGG + Intergenic
1170513030 20:17098544-17098566 AATGGGTATTCTGCAGTTGTTGG - Intergenic
1172533644 20:35653371-35653393 CCAGGTAATCCTGCAGTTCCAGG - Exonic
1174255203 20:49249312-49249334 CATCGGAAACATGCAGATGCTGG - Exonic
1178983533 21:37284369-37284391 CATGGGACTCCTGGAATTCCAGG - Intergenic
1182175001 22:28276093-28276115 CATTGGAGTCCTGGAGTTGGAGG - Intronic
1183274818 22:36887580-36887602 CAGGAGAATGCTGCAGATGCTGG - Intergenic
1183509248 22:38225389-38225411 CATGGGCAGCCTCCAGGTGCTGG + Intronic
950669533 3:14517806-14517828 GGTGGGCATCCTGCAGTGGCCGG + Exonic
954472319 3:50708221-50708243 CTTGGGAATCCTGCTGCTGGAGG + Intronic
955125257 3:56104928-56104950 CTGGGGAATCCTGCAGTTGGAGG + Intronic
955705515 3:61723803-61723825 CATGGGAATCATCCAGTATCTGG - Intronic
955958458 3:64314586-64314608 GATGGGAATCCTGCAGTATTTGG - Intronic
960907465 3:122615819-122615841 CATGGGAATCCTGGCCTTGTTGG - Exonic
966457343 3:180132865-180132887 CTTGGAAATCTTGCAGATGCTGG + Intergenic
967100632 3:186212516-186212538 CATGGCAATCCTTCAGTTAAGGG + Intronic
967982617 3:195074798-195074820 CATGGACATCCTGGAGTTGTAGG + Intronic
968249126 3:197189861-197189883 GGTGGAAATCTTGCAGTTGCTGG - Intronic
969598085 4:8159988-8160010 CATGGGAACCCTGCGGCTGCGGG - Intergenic
971732969 4:30409276-30409298 AATGTGTATTCTGCAGTTGCGGG - Intergenic
973244968 4:48001715-48001737 AATGTGTATTCTGCAGTTGCTGG - Intronic
975329619 4:73099316-73099338 CATGGGGCCCCTGCAGTGGCTGG - Intronic
977444068 4:97106361-97106383 TATGGGAATCCTGCAGTAGGTGG - Intergenic
978960229 4:114668766-114668788 CATGGTAAGCCTGGTGTTGCTGG + Intronic
979554951 4:122035035-122035057 TCTGGGAATCCTGTAGTTGTGGG - Intergenic
980623691 4:135344464-135344486 CATGACAATCCTGCTGTTGGAGG - Intergenic
981308943 4:143276918-143276940 CAAGGGTATCCTGCAGGAGCTGG - Intergenic
981760571 4:148190495-148190517 AATGTGTATTCTGCAGTTGCTGG + Intronic
983374032 4:166900561-166900583 CCAGGGCAGCCTGCAGTTGCTGG - Intronic
988902462 5:35747863-35747885 AATGTGTATTCTGCAGTTGCTGG - Intronic
989460622 5:41694200-41694222 AATGTGTATTCTGCAGTTGCAGG + Intergenic
992761216 5:79952291-79952313 CATGGGAAGCCTCTAATTGCTGG - Intergenic
995243236 5:109909051-109909073 CATGGGAATGATCCAGTTGATGG - Intergenic
995322376 5:110850934-110850956 AATGTGTATGCTGCAGTTGCTGG + Intergenic
999320800 5:150613933-150613955 CATGGGGACCCTGCAGATGATGG + Intronic
1004777730 6:18867496-18867518 AATGGGTATGCTGCAGTTGTTGG - Intergenic
1005123189 6:22413595-22413617 CATTGGATTCCTGAGGTTGCTGG + Intergenic
1006474336 6:34245054-34245076 CATGGGAGCCCTGCAGCGGCTGG - Exonic
1008807164 6:55443427-55443449 TCTGGGACTCCTGTAGTTGCAGG - Intronic
1008871675 6:56279434-56279456 CCTGGGACTCCTGTAGTTCCTGG + Intronic
1011302703 6:85892815-85892837 CATGGGAAAAGTGCAGTTTCTGG + Intergenic
1011817347 6:91208458-91208480 AATGTGTATTCTGCAGTTGCTGG + Intergenic
1015070886 6:129091513-129091535 CATGAAATTCCTGAAGTTGCAGG - Intronic
1017165709 6:151406742-151406764 CATGGGTATGCTGAAGTTACAGG + Intronic
1018993399 6:168692025-168692047 GATGTGAACTCTGCAGTTGCTGG + Intergenic
1022350832 7:29565067-29565089 CAGGCGAATCCTGCCGTTGCTGG + Intronic
1022405881 7:30089365-30089387 CATGTTACTCCTGTAGTTGCTGG - Intronic
1023927660 7:44681738-44681760 CATGGGGATGCTGCATTTGCTGG + Exonic
1027514816 7:79128200-79128222 TATGTGAATCCTGGAGTTTCTGG - Intronic
1027938963 7:84648161-84648183 CATTTGATTCTTGCAGTTGCTGG - Intergenic
1029787015 7:102802219-102802241 AATGTGTATCCTGCAGTTGTTGG - Intronic
1033140224 7:138819878-138819900 CATGGGTATTCTGCTGTTGCTGG - Intronic
1036161313 8:6391062-6391084 CATGTTAATCCTTCAGTCGCTGG - Intergenic
1037839876 8:22237034-22237056 AATGAGGATCCTGCAGTTGTAGG + Intergenic
1039672658 8:39619346-39619368 CATGTGAATTCTGAAGTTGTTGG - Intronic
1041738049 8:61132314-61132336 CAGGGGAATCCTGGAGATGAGGG + Intronic
1047243385 8:123115678-123115700 TATGGGAAACCTGCAGAAGCTGG - Intronic
1049305186 8:141899117-141899139 CATGGGACTCCTTCAGTCACAGG + Intergenic
1049641380 8:143717544-143717566 CTAGGGCAGCCTGCAGTTGCGGG + Intronic
1053562161 9:39207981-39208003 CATGGCTGTCCTGCAGCTGCAGG - Intronic
1053827967 9:42045982-42046004 CATGGCTGTCCTGCAGCTGCAGG - Intronic
1054134957 9:61410977-61410999 CATGGCTGTCCTGCAGCTGCAGG + Intergenic
1054602591 9:67141464-67141486 CATGGCTGTCCTGCAGCTGCAGG + Intergenic
1055476384 9:76667362-76667384 CTTGGGCGTCCTGCAGATGCTGG - Intronic
1056322502 9:85449848-85449870 AATGTGTATTCTGCAGTTGCTGG + Intergenic
1057520539 9:95756227-95756249 TATCGTAATCCTGCTGTTGCAGG - Intergenic
1062467706 9:136688290-136688312 CTTGGGTTTGCTGCAGTTGCGGG + Intergenic
1188141570 X:26557980-26558002 GCTGGGAGTCCTGCATTTGCCGG - Intergenic
1189114906 X:38332180-38332202 GATGGGAACCCTCTAGTTGCAGG + Intronic
1191700191 X:64033743-64033765 CATGGGACTCCTTCAGCTGTAGG - Intergenic
1192169555 X:68845855-68845877 CATGTGGATCCTTCAGTTCCAGG + Intergenic
1195519793 X:105817996-105818018 AATGGGTAGCCTGAAGTTGCTGG + Intergenic
1198579645 X:138049305-138049327 CAGGGGAAGGCTGCAGTTGGGGG - Intergenic
1200090049 X:153631225-153631247 CATGGGTATTCTGCTGTTGTTGG - Intergenic
1200369729 X:155712153-155712175 AATGTGCATCCTGCAGTTGTTGG + Intergenic