ID: 1075783639

View in Genome Browser
Species Human (GRCh38)
Location 10:125033370-125033392
Sequence ACCTTGGCGTGCGCGCTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 10}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075783639_1075783643 9 Left 1075783639 10:125033370-125033392 CCCTCGAGCGCGCACGCCAAGGT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1075783643 10:125033402-125033424 TTAGTAGCAAGCGAGCCAAGTGG No data
1075783639_1075783645 28 Left 1075783639 10:125033370-125033392 CCCTCGAGCGCGCACGCCAAGGT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1075783645 10:125033421-125033443 GTGGTAGAAACCAATCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075783639 Original CRISPR ACCTTGGCGTGCGCGCTCGA GGG (reversed) Intronic
1075783639 10:125033370-125033392 ACCTTGGCGTGCGCGCTCGAGGG - Intronic
1077032058 11:472874-472896 ACCTTGGCGTGTTCGCACGCTGG - Intronic
1084385432 11:68840830-68840852 AACTTGGCCTGCGAGCCCGACGG - Intronic
1085745238 11:79109461-79109483 ACCTTGGCCTGCTTGCTAGAAGG - Intronic
1100977912 12:100142056-100142078 ACCTTGGCGTTCCCGCTCTGTGG - Intronic
1111913551 13:94337952-94337974 AACTTAGCGTGTGCCCTCGAAGG - Intronic
1124249913 15:28099728-28099750 ACCTTGGCGTCCTAGCTGGAGGG - Intergenic
928471622 2:31581329-31581351 ACCTTGGCTTGGGTGTTCGAGGG - Intergenic
942290453 2:174464573-174464595 ACTTTGGCGTGCATGCTTGAAGG + Intronic
948978876 2:241482446-241482468 ACCTCGGCGTGCGGTCTCCAGGG + Intronic
1049740315 8:144237340-144237362 ACAGGGGCCTGCGCGCTCGAAGG - Intronic