ID: 1075783640

View in Genome Browser
Species Human (GRCh38)
Location 10:125033371-125033393
Sequence CACCTTGGCGTGCGCGCTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075783640_1075783645 27 Left 1075783640 10:125033371-125033393 CCTCGAGCGCGCACGCCAAGGTG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1075783645 10:125033421-125033443 GTGGTAGAAACCAATCAGAGAGG No data
1075783640_1075783643 8 Left 1075783640 10:125033371-125033393 CCTCGAGCGCGCACGCCAAGGTG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1075783643 10:125033402-125033424 TTAGTAGCAAGCGAGCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075783640 Original CRISPR CACCTTGGCGTGCGCGCTCG AGG (reversed) Intronic
900206826 1:1435228-1435250 CGCCTTGGCCTCCGCGCTGGAGG - Intronic
906062707 1:42958797-42958819 CTCCCTGGCGTGCTCACTCGGGG + Exonic
908523362 1:64966041-64966063 AAACTTGCCGTGCGCGCTGGGGG + Intronic
1075783640 10:125033371-125033393 CACCTTGGCGTGCGCGCTCGAGG - Intronic
1077361749 11:2143938-2143960 CACCTTGGCTGGGGCGCGCGCGG + Intronic
1082959575 11:58905793-58905815 CGCCTGGGCGCACGCGCTCGCGG - Intronic
1095432064 12:42144805-42144827 CACCTAGGCGAGCGCAGTCGCGG + Exonic
1104429543 12:128705458-128705480 CATCTTGGCCTGTGCGCTCATGG - Exonic
1111096001 13:83516818-83516840 TGCCTTGGCGTCCGCTCTCGAGG + Intergenic
1118514187 14:66508442-66508464 CTCCTCGGCGAGCGCGCTCCCGG + Exonic
1135323617 16:21512548-21512570 CACCCTGGCCTGGGCCCTCGGGG + Intergenic
1136335103 16:29605813-29605835 CACCCTGGCCTGGGCCCTCGGGG + Intergenic
1152723698 17:81935037-81935059 CACCTGGGCGTGCGTGCCTGTGG + Exonic
1157753105 18:50195273-50195295 CACCTGTGCCTGCGCGCGCGCGG - Intergenic
1159817431 18:73093319-73093341 CACCTTGGCATGAGCTCTCACGG + Intergenic
1160897771 19:1410726-1410748 CACAATGGCCTGGGCGCTCGAGG - Intronic
1161108491 19:2455992-2456014 CACCGCGGGGTGCGCGATCGCGG - Intronic
1161326143 19:3665134-3665156 CACCTTGGAGTGAGCGCTTCTGG - Intronic
1165579490 19:36850074-36850096 CACATTGGGGTGCGCTCTCCCGG + Intronic
1167241354 19:48345186-48345208 CACCCTGGCCTACGCGCTGGTGG - Exonic
1168254188 19:55157047-55157069 CACCTTGGCGTGCGGCTCCGTGG + Exonic
1174297689 20:49560836-49560858 CACCTTGGCCTTGGCCCTCGTGG - Intronic
1180014673 21:45074510-45074532 CCCCTCGGCGTGCGCGCGCCCGG + Intronic
1182638762 22:31750204-31750226 TCCCTTGGAGTGCGCGCGCGCGG - Intergenic
1184550694 22:45202860-45202882 CACCTCGGCCTGCGCACTGGTGG + Intronic
949534394 3:4984521-4984543 CACTTTGGGGTGCTCGCTCGGGG - Exonic
966794118 3:183697928-183697950 CACCTCGCCGTGCTCTCTCGCGG + Exonic
976184379 4:82430149-82430171 CCCCTTGGCCCGCGCGCCCGTGG - Exonic
992690534 5:79236647-79236669 CACCATGTCGTTCGCGCTGGAGG + Exonic
1019686304 7:2384003-2384025 CACCTGGGTGTGCGGGCTCTGGG + Intergenic
1057195328 9:93113152-93113174 CCCCTTGGCGGGCCGGCTCGAGG - Exonic
1059119624 9:111630638-111630660 CACCTTGGGCTGCGCGTTCCCGG - Intergenic
1062430958 9:136526687-136526709 CACGTTGGGGTCCGCGCTCAGGG - Intronic