ID: 1075783641 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:125033386-125033408 |
| Sequence | CTACTAAAGCTCAGGCACCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1075783641_1075783643 | -7 | Left | 1075783641 | 10:125033386-125033408 | CCAAGGTGCCTGAGCTTTAGTAG | No data | ||
| Right | 1075783643 | 10:125033402-125033424 | TTAGTAGCAAGCGAGCCAAGTGG | No data | ||||
| 1075783641_1075783645 | 12 | Left | 1075783641 | 10:125033386-125033408 | CCAAGGTGCCTGAGCTTTAGTAG | No data | ||
| Right | 1075783645 | 10:125033421-125033443 | GTGGTAGAAACCAATCAGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1075783641 | Original CRISPR | CTACTAAAGCTCAGGCACCT TGG (reversed) | Intronic | ||