ID: 1075783641

View in Genome Browser
Species Human (GRCh38)
Location 10:125033386-125033408
Sequence CTACTAAAGCTCAGGCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075783641_1075783645 12 Left 1075783641 10:125033386-125033408 CCAAGGTGCCTGAGCTTTAGTAG No data
Right 1075783645 10:125033421-125033443 GTGGTAGAAACCAATCAGAGAGG No data
1075783641_1075783643 -7 Left 1075783641 10:125033386-125033408 CCAAGGTGCCTGAGCTTTAGTAG No data
Right 1075783643 10:125033402-125033424 TTAGTAGCAAGCGAGCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075783641 Original CRISPR CTACTAAAGCTCAGGCACCT TGG (reversed) Intronic
No off target data available for this crispr