ID: 1075783642

View in Genome Browser
Species Human (GRCh38)
Location 10:125033394-125033416
Sequence CTCGCTTGCTACTAAAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075783642_1075783645 4 Left 1075783642 10:125033394-125033416 CCTGAGCTTTAGTAGCAAGCGAG No data
Right 1075783645 10:125033421-125033443 GTGGTAGAAACCAATCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075783642 Original CRISPR CTCGCTTGCTACTAAAGCTC AGG (reversed) Intronic
No off target data available for this crispr