ID: 1075783643

View in Genome Browser
Species Human (GRCh38)
Location 10:125033402-125033424
Sequence TTAGTAGCAAGCGAGCCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075783640_1075783643 8 Left 1075783640 10:125033371-125033393 CCTCGAGCGCGCACGCCAAGGTG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1075783643 10:125033402-125033424 TTAGTAGCAAGCGAGCCAAGTGG No data
1075783641_1075783643 -7 Left 1075783641 10:125033386-125033408 CCAAGGTGCCTGAGCTTTAGTAG No data
Right 1075783643 10:125033402-125033424 TTAGTAGCAAGCGAGCCAAGTGG No data
1075783639_1075783643 9 Left 1075783639 10:125033370-125033392 CCCTCGAGCGCGCACGCCAAGGT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 1075783643 10:125033402-125033424 TTAGTAGCAAGCGAGCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075783643 Original CRISPR TTAGTAGCAAGCGAGCCAAG TGG Intronic
No off target data available for this crispr