ID: 1075783645

View in Genome Browser
Species Human (GRCh38)
Location 10:125033421-125033443
Sequence GTGGTAGAAACCAATCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075783642_1075783645 4 Left 1075783642 10:125033394-125033416 CCTGAGCTTTAGTAGCAAGCGAG No data
Right 1075783645 10:125033421-125033443 GTGGTAGAAACCAATCAGAGAGG No data
1075783640_1075783645 27 Left 1075783640 10:125033371-125033393 CCTCGAGCGCGCACGCCAAGGTG No data
Right 1075783645 10:125033421-125033443 GTGGTAGAAACCAATCAGAGAGG No data
1075783641_1075783645 12 Left 1075783641 10:125033386-125033408 CCAAGGTGCCTGAGCTTTAGTAG No data
Right 1075783645 10:125033421-125033443 GTGGTAGAAACCAATCAGAGAGG No data
1075783639_1075783645 28 Left 1075783639 10:125033370-125033392 CCCTCGAGCGCGCACGCCAAGGT No data
Right 1075783645 10:125033421-125033443 GTGGTAGAAACCAATCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075783645 Original CRISPR GTGGTAGAAACCAATCAGAG AGG Intronic