ID: 1075785598

View in Genome Browser
Species Human (GRCh38)
Location 10:125048144-125048166
Sequence GCCCACGTGGGGGTTTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 78}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075785598_1075785604 6 Left 1075785598 10:125048144-125048166 CCAATGGAAACCCCCACGTGGGC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1075785604 10:125048173-125048195 TTTCCTGTTGCAGCCCTTCCTGG No data
1075785598_1075785613 29 Left 1075785598 10:125048144-125048166 CCAATGGAAACCCCCACGTGGGC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1075785613 10:125048196-125048218 GAGCTGGCCCAGCCCAAGGGAGG No data
1075785598_1075785607 13 Left 1075785598 10:125048144-125048166 CCAATGGAAACCCCCACGTGGGC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1075785607 10:125048180-125048202 TTGCAGCCCTTCCTGGGAGCTGG No data
1075785598_1075785611 25 Left 1075785598 10:125048144-125048166 CCAATGGAAACCCCCACGTGGGC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1075785611 10:125048192-125048214 CTGGGAGCTGGCCCAGCCCAAGG No data
1075785598_1075785605 7 Left 1075785598 10:125048144-125048166 CCAATGGAAACCCCCACGTGGGC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1075785605 10:125048174-125048196 TTCCTGTTGCAGCCCTTCCTGGG No data
1075785598_1075785612 26 Left 1075785598 10:125048144-125048166 CCAATGGAAACCCCCACGTGGGC 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1075785612 10:125048193-125048215 TGGGAGCTGGCCCAGCCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075785598 Original CRISPR GCCCACGTGGGGGTTTCCAT TGG (reversed) Intronic
902046452 1:13528304-13528326 TCCCACCTGGGGGTTTGCAGAGG + Intergenic
902046710 1:13530100-13530122 TCCCACCTGGGGGTTTACAGAGG + Intergenic
910825778 1:91405485-91405507 TCACAGGTGGGGGTTTCCAAAGG - Intergenic
913195899 1:116455537-116455559 GCCCAACTGGGAGTTTCCAGAGG + Intergenic
915004891 1:152626799-152626821 AACCACTTGGGAGTTTCCATGGG - Intergenic
917198545 1:172492147-172492169 GAGCACGTGGGGTTTTCCAAAGG + Intergenic
923684218 1:236142665-236142687 TCCCACGGCGGGGTCTCCATCGG - Exonic
1065828445 10:29593447-29593469 GCCCATGTGTGGATTTCCCTTGG - Intronic
1066452846 10:35547378-35547400 GCCTTTGTGGGGGTTTCCAAGGG - Intronic
1073288006 10:102399966-102399988 GGCCACGTGCTGGGTTCCATGGG + Intronic
1073763156 10:106652459-106652481 GCCCCCGCGGGGCTTTCCCTGGG + Exonic
1075785598 10:125048144-125048166 GCCCACGTGGGGGTTTCCATTGG - Intronic
1076005506 10:126945339-126945361 TCCCACGTGGGCCTCTCCATAGG + Intronic
1077492347 11:2867502-2867524 GGGTACGTGGGGGTTTCCACTGG - Intergenic
1081327642 11:41764871-41764893 GCCCACATGGCTATTTCCATGGG + Intergenic
1083319558 11:61837570-61837592 GCCCAGGTGGCTGTTGCCATTGG + Intronic
1084961053 11:72716936-72716958 GCCCACCAGGGGGTCTTCATAGG - Intronic
1088911271 11:114194221-114194243 GCTCACGTGTGGCTTTGCATAGG + Intronic
1089593258 11:119558685-119558707 GCCAACTTGGGGGTTGCCCTGGG - Intergenic
1091159564 11:133407605-133407627 ACCCACGTGTGGGTTTGCATTGG - Intronic
1094500990 12:31020641-31020663 GGCCAAGTGGGGGTTACCCTGGG + Intergenic
1103216403 12:119204919-119204941 TACCACGTGGGGCTCTCCATGGG + Intronic
1112692728 13:101916042-101916064 GAGCTGGTGGGGGTTTCCATGGG - Intronic
1116957990 14:50943887-50943909 GCCCACCTGGCGGTTTCCAGGGG + Intronic
1119286094 14:73456846-73456868 CCCCACCTGGGGGTTTCAGTAGG - Intronic
1120790989 14:88581722-88581744 GCCAACTTAGAGGTTTCCATTGG + Intronic
1123053821 14:105560068-105560090 GCCCAGGGTGGGGGTTCCATGGG + Intergenic
1123078404 14:105680485-105680507 GCCCAGGGTGGGGGTTCCATGGG + Intergenic
1124555478 15:30721060-30721082 TGCCACGTGGGCCTTTCCATAGG - Intronic
1124675781 15:31684635-31684657 TGCCACGTGGGCCTTTCCATAGG + Intronic
1129264851 15:74388042-74388064 GCCCACGTGGGCCTTTCCGCTGG + Intergenic
1139408580 16:66739918-66739940 GCCCACTTGGGGCTTCCCTTTGG + Intronic
1139458298 16:67102019-67102041 GCCCAGCTGGGTCTTTCCATAGG + Intergenic
1141394855 16:83695558-83695580 GCCTAGCTGTGGGTTTCCATGGG - Intronic
1144281465 17:13731049-13731071 GCCCAAGTTTGGGCTTCCATAGG - Intergenic
1152738444 17:82008711-82008733 GGCCACGTCAGGGTCTCCATGGG - Intronic
1154066372 18:11110771-11110793 GCCCACGTGTGCGTTTCCTTTGG + Intronic
1154329881 18:13421171-13421193 GCCCGTGTAGGGGTGTCCATGGG + Intronic
1155364561 18:25036802-25036824 GCCCACCTGGAGCTTTCCATGGG + Intergenic
1160911278 19:1474910-1474932 GCCCACGTGGGTGTTGACACAGG - Exonic
1162315775 19:9937034-9937056 ACCCACGTGGCCATTTCCATTGG - Intergenic
1163026377 19:14515172-14515194 GCACACGTGGGGCTTACCAGTGG - Exonic
1165910575 19:39223934-39223956 CCTCTCATGGGGGTTTCCATTGG + Intergenic
925055249 2:852238-852260 GCCCAGGTGAGGGTGGCCATGGG + Intergenic
926607728 2:14914344-14914366 GGCCACATGGGGGTTGCCCTTGG + Intergenic
926808481 2:16735198-16735220 GCTCACTTGCCGGTTTCCATAGG - Intergenic
935140408 2:100348360-100348382 GCCCATCTGGGGGTTTCTATTGG + Intergenic
1172703197 20:36864776-36864798 GCCCCCGTGGGGGCTGGCATGGG + Intergenic
1174123685 20:48287205-48287227 ACCCACGTGGAGGTCTGCATTGG + Intergenic
1174309814 20:49643469-49643491 GCCCACCTGGGGTTTGCCTTTGG - Intronic
1175799364 20:61792310-61792332 GCCCACGTGTGGGGTGCCATGGG + Intronic
1177487442 21:21777756-21777778 TCCCACCTGGGTGTTTTCATGGG + Intergenic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1180195889 21:46194186-46194208 GCCCACCTCGCTGTTTCCATGGG + Intronic
953498312 3:43407864-43407886 GCCCACGTGGGGCTTTGCAGGGG + Intronic
954128508 3:48547379-48547401 GCCCACGTGTGTGTGTGCATAGG + Intronic
954620503 3:51992753-51992775 GCCCACGTGGTGCCTTCTATAGG + Intergenic
954782803 3:53073349-53073371 GCACAGGTGGGGGTGTCCAGAGG - Intronic
981490646 4:145336077-145336099 CGCCACGTGGGCCTTTCCATTGG + Intergenic
981646221 4:147001659-147001681 TCCCACGTGGGGATTACAATTGG + Intergenic
985009726 4:185570113-185570135 GCCCAGGTGGGGGCTTCCCAAGG - Intergenic
1000865249 5:166505779-166505801 GACCACTTGTGAGTTTCCATGGG + Intergenic
1001883916 5:175271178-175271200 GCCCGGATGGGGTTTTCCATGGG - Intergenic
1002778398 6:348207-348229 GCCCACGTTGGGGTTGGCACAGG - Exonic
1004979978 6:21012469-21012491 GTCCAGGTGTGGCTTTCCATGGG + Intronic
1006830851 6:36967359-36967381 GCCCTCTTGGGTGTTTCCCTAGG + Intergenic
1007167762 6:39841009-39841031 TCCCACGGGGAGGGTTCCATGGG + Intronic
1023055352 7:36285953-36285975 GTACACCTGGGGGTGTCCATGGG + Intronic
1023779924 7:43646188-43646210 GCCCAGGAGGGGGATTCCCTTGG - Intronic
1032388525 7:131540760-131540782 GCCCTGGTGGAGGTTTCCAGAGG - Intronic
1033337982 7:140469611-140469633 GCCCACATGGGCCTTTTCATAGG - Intronic
1035727189 8:1831941-1831963 GCCAACGTGCTGGTTTCCACAGG - Intronic
1037566263 8:20120805-20120827 GCCCACCTGGGGGATTTCAGGGG + Intergenic
1040285250 8:46097489-46097511 TCCCACCTGGGGGTACCCATGGG - Intergenic
1040322704 8:46326675-46326697 CCCCACCTGGGGGTTGCCTTGGG + Intergenic
1041200884 8:55451351-55451373 GCCCACGTGGGGAGTCACATTGG - Intronic
1043798331 8:84575169-84575191 GCACATGTGGGGGTTTTAATGGG - Intronic
1044539212 8:93391178-93391200 GCCCACATGGGTCTCTCCATAGG + Intergenic
1048539308 8:135327959-135327981 GAACATCTGGGGGTTTCCATTGG + Intergenic
1051932521 9:22403537-22403559 GGCCAAATGGGGGTTGCCATAGG + Intergenic
1057171706 9:92966759-92966781 GCCCAGCTGGGGGTGTCCAGGGG - Intronic
1060747435 9:126146714-126146736 GCCCTTGTGGTGGTTTCCACAGG - Intergenic
1061290747 9:129649206-129649228 GCCCACCTGGGGGCTTCACTGGG - Intergenic
1198843063 X:140880002-140880024 GCCCAGGTGTTGGGTTCCATAGG - Intergenic
1200163538 X:154020854-154020876 GCCCCCGTGGAGGTTAGCATGGG - Intergenic
1201056956 Y:10003435-10003457 GTCCACGTTTGGGCTTCCATAGG - Intergenic