ID: 1075786098

View in Genome Browser
Species Human (GRCh38)
Location 10:125051207-125051229
Sequence CACCATTCGAAAACGGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075786087_1075786098 25 Left 1075786087 10:125051159-125051181 CCGAGGACTCAGGATACCTGGAT 0: 1
1: 0
2: 1
3: 29
4: 186
Right 1075786098 10:125051207-125051229 CACCATTCGAAAACGGTACATGG No data
1075786088_1075786098 9 Left 1075786088 10:125051175-125051197 CCTGGATCCCAAGTTTATGTCCC 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1075786098 10:125051207-125051229 CACCATTCGAAAACGGTACATGG No data
1075786090_1075786098 1 Left 1075786090 10:125051183-125051205 CCAAGTTTATGTCCCCACCCCAG No data
Right 1075786098 10:125051207-125051229 CACCATTCGAAAACGGTACATGG No data
1075786089_1075786098 2 Left 1075786089 10:125051182-125051204 CCCAAGTTTATGTCCCCACCCCA 0: 1
1: 0
2: 1
3: 26
4: 261
Right 1075786098 10:125051207-125051229 CACCATTCGAAAACGGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075786098 Original CRISPR CACCATTCGAAAACGGTACA TGG Intronic
No off target data available for this crispr