ID: 1075786559

View in Genome Browser
Species Human (GRCh38)
Location 10:125053879-125053901
Sequence GTGGAATCTGATCCTCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075786559_1075786564 -4 Left 1075786559 10:125053879-125053901 CCCGGCAGAGGATCAGATTCCAC No data
Right 1075786564 10:125053898-125053920 CCACACAGGGACCCTCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075786559 Original CRISPR GTGGAATCTGATCCTCTGCC GGG (reversed) Intronic