ID: 1075792428

View in Genome Browser
Species Human (GRCh38)
Location 10:125094612-125094634
Sequence ACCAGAGATGTCGCCAGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 125}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075792428_1075792442 15 Left 1075792428 10:125094612-125094634 CCCTATCTGGCGACATCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 125
Right 1075792442 10:125094650-125094672 AGGGAGGCAACACTGGCATCGGG No data
1075792428_1075792441 14 Left 1075792428 10:125094612-125094634 CCCTATCTGGCGACATCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 125
Right 1075792441 10:125094649-125094671 GAGGGAGGCAACACTGGCATCGG No data
1075792428_1075792447 30 Left 1075792428 10:125094612-125094634 CCCTATCTGGCGACATCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 125
Right 1075792447 10:125094665-125094687 GCATCGGGTGGGGAGAGGCCAGG No data
1075792428_1075792445 20 Left 1075792428 10:125094612-125094634 CCCTATCTGGCGACATCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 125
Right 1075792445 10:125094655-125094677 GGCAACACTGGCATCGGGTGGGG No data
1075792428_1075792435 -8 Left 1075792428 10:125094612-125094634 CCCTATCTGGCGACATCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 125
Right 1075792435 10:125094627-125094649 TCTCTGGTCATGCCGGGGTGGGG No data
1075792428_1075792444 19 Left 1075792428 10:125094612-125094634 CCCTATCTGGCGACATCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 125
Right 1075792444 10:125094654-125094676 AGGCAACACTGGCATCGGGTGGG No data
1075792428_1075792437 -4 Left 1075792428 10:125094612-125094634 CCCTATCTGGCGACATCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 125
Right 1075792437 10:125094631-125094653 TGGTCATGCCGGGGTGGGGAGGG No data
1075792428_1075792443 18 Left 1075792428 10:125094612-125094634 CCCTATCTGGCGACATCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 125
Right 1075792443 10:125094653-125094675 GAGGCAACACTGGCATCGGGTGG No data
1075792428_1075792438 -1 Left 1075792428 10:125094612-125094634 CCCTATCTGGCGACATCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 125
Right 1075792438 10:125094634-125094656 TCATGCCGGGGTGGGGAGGGAGG No data
1075792428_1075792436 -5 Left 1075792428 10:125094612-125094634 CCCTATCTGGCGACATCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 125
Right 1075792436 10:125094630-125094652 CTGGTCATGCCGGGGTGGGGAGG No data
1075792428_1075792446 25 Left 1075792428 10:125094612-125094634 CCCTATCTGGCGACATCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 125
Right 1075792446 10:125094660-125094682 CACTGGCATCGGGTGGGGAGAGG No data
1075792428_1075792434 -9 Left 1075792428 10:125094612-125094634 CCCTATCTGGCGACATCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 125
Right 1075792434 10:125094626-125094648 ATCTCTGGTCATGCCGGGGTGGG No data
1075792428_1075792440 8 Left 1075792428 10:125094612-125094634 CCCTATCTGGCGACATCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 125
Right 1075792440 10:125094643-125094665 GGTGGGGAGGGAGGCAACACTGG No data
1075792428_1075792433 -10 Left 1075792428 10:125094612-125094634 CCCTATCTGGCGACATCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 125
Right 1075792433 10:125094625-125094647 CATCTCTGGTCATGCCGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075792428 Original CRISPR ACCAGAGATGTCGCCAGATA GGG (reversed) Intronic
900195025 1:1371718-1371740 ACCACAGATGTCTCCAGATGCGG + Intergenic
900477085 1:2881102-2881124 ACCAGAGATGCCGGCAGGGAGGG - Intergenic
905232751 1:36525233-36525255 ACCACAGATGTGGCCATGTAGGG - Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
906319605 1:44808056-44808078 ACTAGAGGTGTAGCCAGCTAGGG - Intergenic
907384423 1:54116896-54116918 ACCAGAGATGGCGCAGAATAAGG - Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
914782843 1:150801407-150801429 AGAAGAGATGTGGCCAGGTACGG - Intronic
916551625 1:165855331-165855353 AGCAAAGATGTCCCCAAATAAGG + Intronic
917975827 1:180237010-180237032 AACAGAGATGTGGGCAAATAGGG + Intronic
921937238 1:220806638-220806660 CCCAGAGATGGGGCCAGATCTGG - Intronic
1063061016 10:2552615-2552637 GACAGAGAAGTGGCCAGATATGG - Intergenic
1067383575 10:45797593-45797615 ACCAGAGATGTTGCAAGATGAGG + Intergenic
1067560514 10:47301395-47301417 ACCATAGCTGACGCCAGCTAGGG - Intronic
1067880603 10:50041207-50041229 ACCAGAGATGTTGCAAGATGAGG - Intergenic
1067891278 10:50138162-50138184 ACCAGAGATGTTGCAAGATGAGG + Intergenic
1068930489 10:62584203-62584225 ACCAGTGATGAAGCCAGAGATGG + Intronic
1069564475 10:69454072-69454094 CCCAGAGATGGCACCAGAGATGG - Intronic
1071518231 10:86313326-86313348 CCCTGAGATGTTGACAGATAAGG + Intronic
1075792428 10:125094612-125094634 ACCAGAGATGTCGCCAGATAGGG - Intronic
1076803827 10:132845334-132845356 TCCAGAGATGTCTGCAGACATGG - Intronic
1080383791 11:31798831-31798853 ACCAGAGGTGGCGCCCGATTCGG - Intronic
1081298239 11:41418585-41418607 TTCAGAGATATCGCCAGCTAGGG + Intronic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084359626 11:68661088-68661110 ACCAGCGATGTCTCCAGACATGG + Intergenic
1088371178 11:109090018-109090040 TCCAGAGATGGTGCCAGGTAGGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1090571740 11:128054704-128054726 ACCAGAGTTGCTGCCACATAAGG + Intergenic
1090707759 11:129354747-129354769 ACCAGCGATGTGGCGAGAGAGGG - Intergenic
1092946211 12:13456745-13456767 ACCAGAGAAGTCACCAGAAAGGG - Intergenic
1103426559 12:120840555-120840577 ACCAGAATTGTGGCCAGATGCGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1106284148 13:28304487-28304509 ACCAGACAGGTGGGCAGATATGG - Intronic
1106502116 13:30339093-30339115 CCCAGAGTTGTAGCCAGATAAGG + Intergenic
1110976938 13:81850020-81850042 GCCAGAGATTTAGCTAGATAGGG - Intergenic
1111958201 13:94780967-94780989 ATGACAGATGTAGCCAGATATGG - Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1118362596 14:65069024-65069046 AACAGAGAGGTAGCCAGGTAAGG + Intronic
1119382436 14:74237957-74237979 ACCAGAGATGACACCATGTAAGG + Intergenic
1120681355 14:87484691-87484713 GCCAGAGATGTCCCGAGAAATGG + Intergenic
1121640188 14:95480166-95480188 CCCAGGGATGTCCCCAGACAGGG - Intergenic
1128755830 15:70183047-70183069 ACCAGAGGTGGCGCCAGATCTGG - Intergenic
1129500651 15:76034442-76034464 ACCTTAGATGTCGCCAAAGAGGG - Intronic
1130127772 15:81108403-81108425 CCCACAGTTGTGGCCAGATAAGG + Intronic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1141068174 16:80930768-80930790 AGCCGAGATGGCGCCAGAGATGG + Intergenic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1142197250 16:88744601-88744623 ATCCGAGATGTAGCCAGAGACGG - Intronic
1142917873 17:3157173-3157195 ACCAGAGATTTAGCAAGATGAGG - Intergenic
1144864216 17:18324440-18324462 ACCAGAGCTGTCCCCACTTAGGG - Intergenic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1153671507 18:7416634-7416656 ACTAGAGATGTGGCCAGTAATGG - Intergenic
1154265555 18:12875724-12875746 ACCAGAGAGATGGACAGATAAGG - Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1157909219 18:51599323-51599345 ACTAGAGTTGTCGTCAGATCAGG + Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1160891188 19:1379599-1379621 ACCACAGATGTCCCCAGACGTGG + Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161515309 19:4693096-4693118 ACCACAGATGTCCCTAGATGTGG - Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161554621 19:4933641-4933663 AACAGTGATGTCGCCAAAAAGGG - Intronic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1164856389 19:31527810-31527832 AGCAGAGATGTCATCAGAGAAGG + Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
925187115 2:1855802-1855824 ACCAGAGATGAAGCAAGATCAGG - Intronic
927496385 2:23554414-23554436 ACCCGCGCTGTCTCCAGATAGGG - Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
929821640 2:45278759-45278781 ATCAGAGATCTCCCCAGATTAGG + Intergenic
937926928 2:127174836-127174858 GCCAGAGAAGTCCCCAGAGAAGG + Intergenic
944551221 2:200846233-200846255 ACCAGAGAATTCACCAGAGAAGG + Intergenic
947588793 2:231372831-231372853 ACCAGAGATGTCCCCATTGAAGG - Intronic
948070339 2:235116280-235116302 ATGAGAGATGTGGCCAGATGAGG - Intergenic
1170339723 20:15310716-15310738 AACAGAGAAGTCCTCAGATAAGG + Intronic
1172313498 20:33935529-33935551 ACCAGAGACCTGGCCAGAGATGG + Intergenic
1172605699 20:36212150-36212172 TCCAGAGATGTGGCCAGCTGTGG + Intronic
1173046574 20:39518200-39518222 ACCAGAGAGGAAGCCAGAGATGG - Intergenic
1174602010 20:51732337-51732359 CCCTGGGATGTCGCCAGCTAAGG + Intronic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1184015658 22:41784063-41784085 ACCACAGATGAGGCCAGAGAAGG + Intronic
950850337 3:16056293-16056315 ACCAGAGATGTGGCCAGAGAGGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
960147114 3:114215320-114215342 ATCAGAGATGGGGCAAGATAGGG + Intergenic
965604381 3:170484502-170484524 ACCAGTCATATGGCCAGATATGG + Intronic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
970178175 4:13360099-13360121 ACCAAAGATGTCCCCAGTAAAGG - Intergenic
975865757 4:78722184-78722206 ACCTGAGATTTCTCCAGATTGGG + Intergenic
976270327 4:83223996-83224018 ACCTGAGCTGTTGCCAGCTAGGG + Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
981432370 4:144676611-144676633 CCCAGAGATGGCTCCAGAGATGG - Intronic
983737270 4:171077543-171077565 ACCAGAGATGTCTCCACATCTGG + Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985426061 4:189831838-189831860 ACAAGTTATGTCACCAGATAAGG - Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987944071 5:24581422-24581444 AGAAGAGATGTAGCAAGATAAGG - Intronic
991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG + Intergenic
995373733 5:111450495-111450517 AACAGACATGTGGCCAGATGCGG + Intronic
995452814 5:112321193-112321215 AGGAGAGATGTTGCCAGATCAGG + Intronic
996233819 5:121102017-121102039 ACCAGTGATGTCACAACATAAGG + Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
998687092 5:144540438-144540460 AACAGAGGTGTCCCCAGATGAGG - Intergenic
999710148 5:154310760-154310782 ACCAGTGATGTGGCCAGGCACGG - Intronic
1003340048 6:5211894-5211916 ACCAGAGAAGTTGCCAGAACTGG - Intronic
1005316370 6:24606463-24606485 CCCAGAGATGGGGCCAGAAATGG + Intronic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1012244100 6:96906914-96906936 TCCAGAGAAGTCTCCAGAGAAGG + Intergenic
1013260032 6:108432686-108432708 ACCAGAGATGGGGCCTGATTAGG + Intronic
1013346616 6:109266428-109266450 CCTAGAGATGCCGCAAGATAAGG + Intergenic
1017508910 6:155094703-155094725 ACCATAGATATAGCCAGGTATGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1026079656 7:67206338-67206360 AGCAGAGATGTGGCCAGGCACGG + Intronic
1026697193 7:72605640-72605662 AGCAGAGATGTGGCCAGGCACGG - Intronic
1029168132 7:98610486-98610508 TCCAGATCTGTCTCCAGATATGG + Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1038668373 8:29561486-29561508 ACACGAGATGTCCCCTGATATGG - Intergenic
1041765190 8:61411793-61411815 AGCAGAGATGTCGCCCCATGTGG + Intronic
1043508268 8:80924155-80924177 ATCAGAGCTGCCGCCAGACAAGG - Intergenic
1047310136 8:123685026-123685048 ACCAGAGATTTCACTCGATAGGG - Intronic
1056831972 9:89924564-89924586 ACCAGAGAAGACTCCAGTTAGGG + Intergenic
1056923275 9:90810583-90810605 ACCAGGGAGCTCTCCAGATATGG + Intronic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1185942007 X:4332360-4332382 ACCTGAGATGTTACCTGATACGG + Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186256117 X:7721907-7721929 ATCAGGGATGCCTCCAGATATGG + Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1189366799 X:40395145-40395167 ACCAGAGATGTCCCCAGTTGAGG + Intergenic
1192013816 X:67305878-67305900 ACCACAGATGTGGCCTTATATGG + Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196338561 X:114568514-114568536 AACAGAGATGACAACAGATAGGG + Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1200704027 Y:6426249-6426271 ACCAGAGAGGTGGCCAGAAAGGG - Intergenic
1201030084 Y:9738459-9738481 ACCAGAGAGGTGGCCAGAAAGGG + Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201727131 Y:17166290-17166312 ACCTGAGATGTTACCTGATAAGG + Intergenic
1202178470 Y:22119249-22119271 ACCAGAGAGATGGCCAGAAAGGG - Intergenic
1202212891 Y:22467145-22467167 ACCAGAGAGATGGCCAGAAAGGG + Intergenic