ID: 1075793510

View in Genome Browser
Species Human (GRCh38)
Location 10:125102842-125102864
Sequence TACAGGACTTGCAGAGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075793501_1075793510 29 Left 1075793501 10:125102790-125102812 CCTTGAATTTGATACAGAAGCCA 0: 1
1: 0
2: 1
3: 21
4: 171
Right 1075793510 10:125102842-125102864 TACAGGACTTGCAGAGCCAGTGG No data
1075793503_1075793510 9 Left 1075793503 10:125102810-125102832 CCATCTGAGCTTTGTCTCGAGGG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1075793510 10:125102842-125102864 TACAGGACTTGCAGAGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075793510 Original CRISPR TACAGGACTTGCAGAGCCAG TGG Intronic
No off target data available for this crispr