ID: 1075794371

View in Genome Browser
Species Human (GRCh38)
Location 10:125108581-125108603
Sequence GTGGAACGTCACCATGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075794371_1075794376 16 Left 1075794371 10:125108581-125108603 CCCTGGGCATGGTGACGTTCCAC No data
Right 1075794376 10:125108620-125108642 GAGAGCAAACACACGCCTTCTGG No data
1075794371_1075794377 17 Left 1075794371 10:125108581-125108603 CCCTGGGCATGGTGACGTTCCAC No data
Right 1075794377 10:125108621-125108643 AGAGCAAACACACGCCTTCTGGG No data
1075794371_1075794378 18 Left 1075794371 10:125108581-125108603 CCCTGGGCATGGTGACGTTCCAC No data
Right 1075794378 10:125108622-125108644 GAGCAAACACACGCCTTCTGGGG No data
1075794371_1075794374 -10 Left 1075794371 10:125108581-125108603 CCCTGGGCATGGTGACGTTCCAC No data
Right 1075794374 10:125108594-125108616 GACGTTCCACAGAGCAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075794371 Original CRISPR GTGGAACGTCACCATGCCCA GGG (reversed) Intronic