ID: 1075794372

View in Genome Browser
Species Human (GRCh38)
Location 10:125108582-125108604
Sequence TGTGGAACGTCACCATGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075794372_1075794377 16 Left 1075794372 10:125108582-125108604 CCTGGGCATGGTGACGTTCCACA No data
Right 1075794377 10:125108621-125108643 AGAGCAAACACACGCCTTCTGGG No data
1075794372_1075794378 17 Left 1075794372 10:125108582-125108604 CCTGGGCATGGTGACGTTCCACA No data
Right 1075794378 10:125108622-125108644 GAGCAAACACACGCCTTCTGGGG No data
1075794372_1075794376 15 Left 1075794372 10:125108582-125108604 CCTGGGCATGGTGACGTTCCACA No data
Right 1075794376 10:125108620-125108642 GAGAGCAAACACACGCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075794372 Original CRISPR TGTGGAACGTCACCATGCCC AGG (reversed) Intronic