ID: 1075794375

View in Genome Browser
Species Human (GRCh38)
Location 10:125108600-125108622
Sequence CTCAGACCCTTTCTGCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075794375_1075794376 -3 Left 1075794375 10:125108600-125108622 CCACAGAGCAGAAAGGGTCTGAG No data
Right 1075794376 10:125108620-125108642 GAGAGCAAACACACGCCTTCTGG No data
1075794375_1075794377 -2 Left 1075794375 10:125108600-125108622 CCACAGAGCAGAAAGGGTCTGAG No data
Right 1075794377 10:125108621-125108643 AGAGCAAACACACGCCTTCTGGG No data
1075794375_1075794378 -1 Left 1075794375 10:125108600-125108622 CCACAGAGCAGAAAGGGTCTGAG No data
Right 1075794378 10:125108622-125108644 GAGCAAACACACGCCTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075794375 Original CRISPR CTCAGACCCTTTCTGCTCTG TGG (reversed) Intronic