ID: 1075794378

View in Genome Browser
Species Human (GRCh38)
Location 10:125108622-125108644
Sequence GAGCAAACACACGCCTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075794372_1075794378 17 Left 1075794372 10:125108582-125108604 CCTGGGCATGGTGACGTTCCACA No data
Right 1075794378 10:125108622-125108644 GAGCAAACACACGCCTTCTGGGG No data
1075794375_1075794378 -1 Left 1075794375 10:125108600-125108622 CCACAGAGCAGAAAGGGTCTGAG No data
Right 1075794378 10:125108622-125108644 GAGCAAACACACGCCTTCTGGGG No data
1075794371_1075794378 18 Left 1075794371 10:125108581-125108603 CCCTGGGCATGGTGACGTTCCAC No data
Right 1075794378 10:125108622-125108644 GAGCAAACACACGCCTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075794378 Original CRISPR GAGCAAACACACGCCTTCTG GGG Intronic