ID: 1075794457

View in Genome Browser
Species Human (GRCh38)
Location 10:125109240-125109262
Sequence CTGCCTGGGAGCATCTCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075794457_1075794468 26 Left 1075794457 10:125109240-125109262 CCAGCGGAGATGCTCCCAGGCAG No data
Right 1075794468 10:125109289-125109311 AAGAGCGTGGATGTCCAACATGG No data
1075794457_1075794467 13 Left 1075794457 10:125109240-125109262 CCAGCGGAGATGCTCCCAGGCAG No data
Right 1075794467 10:125109276-125109298 CTTGTCTGGGTGAAAGAGCGTGG No data
1075794457_1075794464 -1 Left 1075794457 10:125109240-125109262 CCAGCGGAGATGCTCCCAGGCAG No data
Right 1075794464 10:125109262-125109284 GGCAGGGCCTGGTACTTGTCTGG No data
1075794457_1075794465 0 Left 1075794457 10:125109240-125109262 CCAGCGGAGATGCTCCCAGGCAG No data
Right 1075794465 10:125109263-125109285 GCAGGGCCTGGTACTTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075794457 Original CRISPR CTGCCTGGGAGCATCTCCGC TGG (reversed) Intronic
No off target data available for this crispr