ID: 1075795429

View in Genome Browser
Species Human (GRCh38)
Location 10:125116492-125116514
Sequence TCCCACTTTTAGCACCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075795429_1075795435 28 Left 1075795429 10:125116492-125116514 CCATGGGGGTGCTAAAAGTGGGA No data
Right 1075795435 10:125116543-125116565 CGAGCTAAAGCCACAGCCCTGGG No data
1075795429_1075795434 27 Left 1075795429 10:125116492-125116514 CCATGGGGGTGCTAAAAGTGGGA No data
Right 1075795434 10:125116542-125116564 CCGAGCTAAAGCCACAGCCCTGG No data
1075795429_1075795436 29 Left 1075795429 10:125116492-125116514 CCATGGGGGTGCTAAAAGTGGGA No data
Right 1075795436 10:125116544-125116566 GAGCTAAAGCCACAGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075795429 Original CRISPR TCCCACTTTTAGCACCCCCA TGG (reversed) Intronic