ID: 1075799144

View in Genome Browser
Species Human (GRCh38)
Location 10:125141997-125142019
Sequence GGGGCTGGTGGGACACAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075799139_1075799144 -6 Left 1075799139 10:125141980-125142002 CCAGGCACTTTCCAAGAGGGGCT 0: 1
1: 0
2: 2
3: 11
4: 156
Right 1075799144 10:125141997-125142019 GGGGCTGGTGGGACACAGTGTGG No data
1075799131_1075799144 28 Left 1075799131 10:125141946-125141968 CCAGCGGCTATGGCGGACGAAGA 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1075799144 10:125141997-125142019 GGGGCTGGTGGGACACAGTGTGG No data
1075799134_1075799144 1 Left 1075799134 10:125141973-125141995 CCTGTTCCCAGGCACTTTCCAAG 0: 1
1: 0
2: 2
3: 25
4: 285
Right 1075799144 10:125141997-125142019 GGGGCTGGTGGGACACAGTGTGG No data
1075799138_1075799144 -5 Left 1075799138 10:125141979-125142001 CCCAGGCACTTTCCAAGAGGGGC 0: 1
1: 0
2: 0
3: 4
4: 140
Right 1075799144 10:125141997-125142019 GGGGCTGGTGGGACACAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075799144 Original CRISPR GGGGCTGGTGGGACACAGTG TGG Intronic
No off target data available for this crispr