ID: 1075807338

View in Genome Browser
Species Human (GRCh38)
Location 10:125199383-125199405
Sequence GAGAGAGTCAAGAATATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075807337_1075807338 2 Left 1075807337 10:125199358-125199380 CCTTCTCATAATTGAAGAGAACA No data
Right 1075807338 10:125199383-125199405 GAGAGAGTCAAGAATATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075807338 Original CRISPR GAGAGAGTCAAGAATATTTC AGG Intergenic
No off target data available for this crispr