ID: 1075809429

View in Genome Browser
Species Human (GRCh38)
Location 10:125214248-125214270
Sequence CTCACATTGCAGTCAGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075809429_1075809433 22 Left 1075809429 10:125214248-125214270 CCCCAGCCTGACTGCAATGTGAG No data
Right 1075809433 10:125214293-125214315 GCCTTCAGTCCCCTGTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075809429 Original CRISPR CTCACATTGCAGTCAGGCTG GGG (reversed) Intergenic
No off target data available for this crispr