ID: 1075809645

View in Genome Browser
Species Human (GRCh38)
Location 10:125215633-125215655
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075809642_1075809645 -10 Left 1075809642 10:125215620-125215642 CCTGAAGAAGATGCTGGAGGAGC No data
Right 1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG No data
1075809640_1075809645 -6 Left 1075809640 10:125215616-125215638 CCTTCCTGAAGAAGATGCTGGAG No data
Right 1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG No data
1075809633_1075809645 26 Left 1075809633 10:125215584-125215606 CCTGACTTGGCAGTTCCAGCTCA No data
Right 1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG No data
1075809639_1075809645 -5 Left 1075809639 10:125215615-125215637 CCCTTCCTGAAGAAGATGCTGGA No data
Right 1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG No data
1075809631_1075809645 30 Left 1075809631 10:125215580-125215602 CCACCCTGACTTGGCAGTTCCAG No data
Right 1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG No data
1075809637_1075809645 11 Left 1075809637 10:125215599-125215621 CCAGCTCAGGGACAGGCCCTTCC No data
Right 1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG No data
1075809632_1075809645 27 Left 1075809632 10:125215583-125215605 CCCTGACTTGGCAGTTCCAGCTC No data
Right 1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075809645 Original CRISPR CTGGAGGAGCAGAGGGAAGA AGG Intergenic
No off target data available for this crispr