ID: 1075811449

View in Genome Browser
Species Human (GRCh38)
Location 10:125227604-125227626
Sequence GACCTTTGTGGGCTTGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075811440_1075811449 17 Left 1075811440 10:125227564-125227586 CCCAGACTCCCTGAGCTTAAATT No data
Right 1075811449 10:125227604-125227626 GACCTTTGTGGGCTTGGCCAAGG No data
1075811442_1075811449 9 Left 1075811442 10:125227572-125227594 CCCTGAGCTTAAATTGCAGTTCC No data
Right 1075811449 10:125227604-125227626 GACCTTTGTGGGCTTGGCCAAGG No data
1075811443_1075811449 8 Left 1075811443 10:125227573-125227595 CCTGAGCTTAAATTGCAGTTCCA No data
Right 1075811449 10:125227604-125227626 GACCTTTGTGGGCTTGGCCAAGG No data
1075811438_1075811449 25 Left 1075811438 10:125227556-125227578 CCCTGAGGCCCAGACTCCCTGAG No data
Right 1075811449 10:125227604-125227626 GACCTTTGTGGGCTTGGCCAAGG No data
1075811441_1075811449 16 Left 1075811441 10:125227565-125227587 CCAGACTCCCTGAGCTTAAATTG No data
Right 1075811449 10:125227604-125227626 GACCTTTGTGGGCTTGGCCAAGG No data
1075811439_1075811449 24 Left 1075811439 10:125227557-125227579 CCTGAGGCCCAGACTCCCTGAGC No data
Right 1075811449 10:125227604-125227626 GACCTTTGTGGGCTTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075811449 Original CRISPR GACCTTTGTGGGCTTGGCCA AGG Intergenic
No off target data available for this crispr