ID: 1075813250

View in Genome Browser
Species Human (GRCh38)
Location 10:125244313-125244335
Sequence TGCCATTTCAGACTTGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075813250_1075813256 17 Left 1075813250 10:125244313-125244335 CCATTCCCAAGTCTGAAATGGCA No data
Right 1075813256 10:125244353-125244375 GGTGTTGGTAAAGCACTGATAGG No data
1075813250_1075813254 -4 Left 1075813250 10:125244313-125244335 CCATTCCCAAGTCTGAAATGGCA No data
Right 1075813254 10:125244332-125244354 GGCAAGACAGTCACAGCTGCGGG No data
1075813250_1075813255 2 Left 1075813250 10:125244313-125244335 CCATTCCCAAGTCTGAAATGGCA No data
Right 1075813255 10:125244338-125244360 ACAGTCACAGCTGCGGGTGTTGG No data
1075813250_1075813253 -5 Left 1075813250 10:125244313-125244335 CCATTCCCAAGTCTGAAATGGCA No data
Right 1075813253 10:125244331-125244353 TGGCAAGACAGTCACAGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075813250 Original CRISPR TGCCATTTCAGACTTGGGAA TGG (reversed) Intergenic
No off target data available for this crispr