ID: 1075821908

View in Genome Browser
Species Human (GRCh38)
Location 10:125321779-125321801
Sequence CTGTCCTAAGTGCTGGGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075821908_1075821912 0 Left 1075821908 10:125321779-125321801 CCATACCCCAGCACTTAGGACAG No data
Right 1075821912 10:125321802-125321824 TATATAATCATAGAAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075821908 Original CRISPR CTGTCCTAAGTGCTGGGGTA TGG (reversed) Intergenic
No off target data available for this crispr